TotalSeq™-D0301 anti-mouse Hashtag 1 Antibody

Pricing & Availability
Clone
M1/42; 30-F11;
Regulatory Status
RUO
Other Names
Mouse major histocompatibility complex H-2, MHC, T200, Ly-5, LCA
Isotype
Rat IgG2a, κ/Rat IgG2b, κ
Barcode Sequence
ACCCACCAGTAAGAC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
113902 10 µg 414€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

TotalSeq™ anti-mouse Hashtag reagent is a mixture of two monoclonal antibodies conjugated to the same oligonucleotide. The antibodies are specific against mouse CD45 and MHC class I (of a, b,  d, j, k, s, and u haplotypes) and can be used to label hematopoietic and non-hematopoietic cells in most commonly used mouse strains for multiplex single cell sequencing analysis. The conjugated antibodies are pre-mixed to be used following an optimized protocol similar to the CITE-seq workflow.

CD45 is a 180-240 kD glycoprotein also known as the leukocyte common antigen (LCA), T200, or Ly-5. It is a member of the protein tyrosine phosphatase (PTP) family, expressed on all hematopoietic cells except mature erythrocytes and platelets. CD45 plays a key role in TCR and BCR signal transduction.

MHC class I is involved in antigen presentation to T cells expressing CD3/TCR and CD8 proteins. The M1/42 antibody reacts with the H-2 MHC class I alloantigens expressed on nucleated cells from mice of the a, b, d, j, k, s, and u haplotypes (Stallcup, KC et al, 1981).

Importantly, some cell lines or experimental models may lack or express very low levels of either or both CD45 and MHC I molecules. We recommend a pilot experiment before single cell proteogenomics to confirm expression of these molecules in your experimental system. Different mouse strains express different MHC I haplotypes. Please refer to the supplemental table for detailed information about the haplotype of your experimental model. The supplemental table and summary below are not exhaustive and provide just a summary of common laboratory mouse strains recognized by TotalSeq™ anti-mouse Hashtags.

Mouse strains recognized by clone M1/42: 129/-; A/J; AKR/J; BALB/cAnN; BALB/cBy; BALB/CJ; BXSB/Mp; C3H/Bi; C3H/He; C3HeB/FeJ; C57BL/6; C57BL/10; C57BLR/cdj; C57L/J; C58/J; C.B-17; CBA/Ca; CBA/J; CBA/N; CE/J; DA/HuSn; GRS/J; HRS/J; I/LnJ; LP/J; MA/MyJ; MRL/Mp; NOD; NZB/-; PL/J; RF/J; SEC/-; SJL/J; ST/bJ; SWR/J.

Strains that are not recognized by clone M1/42: BDP/J; BUB/BnJ; DBA/1; FVB/N; NZW/-; P/J; SM/J.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 0.5 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_3683141 (BioLegend Cat. No. 113902)

Related FAQs

There are no FAQs for this product.

Other Formats

View All H-2/CD45 Reagents Request Custom Conjugation
Description Clone Applications
TotalSeq™-A0301 anti-mouse Hashtag 1 M1/42; 30-F11 PG
TotalSeq™-A0302 anti-mouse Hashtag 2 M1/42; 30-F11 PG
TotalSeq™-A0303 anti-mouse Hashtag 3 M1/42; 30-F11 PG
TotalSeq™-A0304 anti-mouse Hashtag 4 M1/42; 30-F11 PG
TotalSeq™-A0305 anti-mouse Hashtag 5 M1/42; 30-F11 PG
TotalSeq™-A0306 anti-mouse Hashtag 6 M1/42; 30-F11 PG
TotalSeq™-A0307 anti-mouse Hashtag 7 M1/42; 30-F11 PG
TotalSeq™-A0308 anti-mouse Hashtag 8 M1/42; 30-F11 PG
TotalSeq™-A0309 anti-mouse Hashtag 9 M1/42; 30-F11 PG
TotalSeq™-A0310 anti-mouse Hashtag 10 M1/42; 30-F11 PG
TotalSeq™-A0311 anti-mouse Hashtag 11 M1/42; 30-F11 PG
TotalSeq™-A0312 anti-mouse Hashtag 12 M1/42; 30-F11 PG
TotalSeq™-A0313 anti-mouse Hashtag 13 M1/42; 30-F11 PG
TotalSeq™-A0314 anti-mouse Hashtag 14 M1/42; 30-F11 PG
TotalSeq™-A0315 anti-mouse Hashtag 15 M1/42; 30-F11 PG
TotalSeq™-C0301 anti-mouse Hashtag 1 M1/42; 30-F11 PG
TotalSeq™-C0302 anti-mouse Hashtag 2 M1/42; 30-F11 PG
TotalSeq™-C0303 anti-mouse Hashtag 3 M1/42; 30-F11 PG
TotalSeq™-C0304 anti-mouse Hashtag 4 M1/42; 30-F11 PG
TotalSeq™-C0305 anti-mouse Hashtag 5 M1/42; 30-F11 PG
TotalSeq™-B0301 anti-mouse Hashtag 1 M1/42; 30-F11 PG
TotalSeq™-B0302 anti-mouse Hashtag 2 M1/42; 30-F11 PG
TotalSeq™-B0303 anti-mouse Hashtag 3 M1/42; 30-F11 PG
TotalSeq™-B0304 anti-mouse Hashtag 4 M1/42; 30-F11 PG
TotalSeq™-B0305 anti-mouse Hashtag 5 M1/42; 30-F11 PG
TotalSeq™-B0306 anti-mouse Hashtag 6 M1/42; 30-F11 PG
TotalSeq™-B0307 anti-mouse Hashtag 7 M1/42; 30-F11 PG
TotalSeq™-B0308 anti-mouse Hashtag 8 M1/42; 30-F11 PG
TotalSeq™-B0309 anti-mouse Hashtag 9 M1/42; 30-F11 PG
TotalSeq™-B0310 anti-mouse Hashtag 10 M1/42; 30-F11 PG
TotalSeq™-C0306 anti-mouse Hashtag 6 M1/42; 30-F11 PG
TotalSeq™-C0307 anti-mouse Hashtag 7 M1/42; 30-F11 PG
TotalSeq™-C0308 anti-mouse Hashtag 8 M1/42; 30-F11 PG
TotalSeq™-C0309 anti-mouse Hashtag 9 M1/42; 30-F11 PG
TotalSeq™-C0310 anti-mouse Hashtag 10 M1/42; 30-F11 PG
TotalSeq™-C0311 anti-mouse Hashtag 11 M1/42; 30-F11 PG
TotalSeq™-C0312 anti-mouse Hashtag 12 M1/42; 30-F11 PG
TotalSeq™-C0313 anti-mouse Hashtag 13 M1/42; 30-F11 PG
TotalSeq™-C0314 anti-mouse Hashtag 14 M1/42; 30-F11 PG
TotalSeq™-C0315 anti-mouse Hashtag 15 M1/42; 30-F11 PG
TotalSeq™-C0316 anti-mouse Hashtag 16 M1/42; 30-F11 PG
TotalSeq™-C0326 anti-mouse Hashtag 20 M1/42; 30-F11 PG
TotalSeq™-C0325 anti-mouse Hashtag 19 M1/42; 30-F11 PG
TotalSeq™-A0325 anti-mouse Hashtag 19 M1/42; 30-F11 PG
TotalSeq™-A0326 anti-mouse Hashtag 20 M1/42; 30-F11 PG
TotalSeq™-B0317 anti-mouse Hashtag 17 M1/42; 30-F11 PG
TotalSeq™-B0318 anti-mouse Hashtag 18 M1/42; 30-F11 PG
TotalSeq™-B0326 anti-mouse Hashtag 20 M1/42; 30-F11 PG
TotalSeq™-B0325 anti-mouse Hashtag 19 M1/42; 30-F11 PG
TotalSeq™-B0312 anti-mouse Hashtag 12 M1/42; 30-F11 PG
TotalSeq™-B0313 anti-mouse Hashtag 13 M1/42; 30-F11 PG
TotalSeq™-B0314 anti-mouse Hashtag 14 M1/42; 30-F11 PG
TotalSeq™-B0315 anti-mouse Hashtag 15 M1/42; 30-F11 PG
TotalSeq™-B0316 anti-mouse Hashtag 16 M1/42; 30-F11 PG
TotalSeq™-B0311 anti-mouse Hashtag 11 M1/42; 30-F11 PG
TotalSeq™-A0316 anti-mouse Hashtag 16 M1/42; 30-F11 PG
TotalSeq™-A0321 anti-mouse Hashtag 21 M1/42; 30-F11 PG
TotalSeq™-C0321 anti-mouse Hashtag 21 M1/42; 30-F11 PG
TotalSeq™-C0318 anti-mouse Hashtag 18 M1/42; 30-F11 PG
TotalSeq™-C0317 anti-mouse Hashtag 17 M1/42; 30-F11 PG
TotalSeq™-C0322 anti-mouse Hashtag 22 M1/42; 30-F11 PG
TotalSeq™-C0323 anti-mouse Hashtag 23 M1/42; 30-F11 PG
TotalSeq™-C0324 anti-mouse Hashtag 24 M1/42; 30-F11 PG
TotalSeq™-A0317 anti-mouse Hashtag 17 M1/42; 30-F11 PG
TotalSeq™-A0318 anti-mouse Hashtag 18 M1/42; 30-F11 PG
TotalSeq™-A0322 anti-mouse Hashtag 22 M1/42; 30-F11 PG
TotalSeq™-B0322 anti-mouse Hashtag 22 M1/42; 30-F11 PG
TotalSeq™-A0323 anti-mouse Hashtag 23 M1/42; 30-F11 PG
TotalSeq™-B0324 anti-mouse Hashtag 24 M1/42; 30-F11 PG
TotalSeq™-B0321 anti-mouse Hashtag 21 M1/42; 30-F11 PG
TotalSeq™-B0323 anti-mouse Hashtag 23 M1/42; 30-F11 PG
TotalSeq™-A0324 anti-mouse Hashtag 24 M1/42; 30-F11 PG
TotalSeq™-D0301 anti-mouse Hashtag 1 M1/42; 30-F11 PG
TotalSeq™-D0302 anti-mouse Hashtag 2 M1/42; 30-F11 PG
Go To Top Version: 1    Revision Date: 03-17-2025

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • TotalSeq™-A0301 anti-mouse Hashtag 1

  • TotalSeq™-A0302 anti-mouse Hashtag 2

  • TotalSeq™-A0303 anti-mouse Hashtag 3

  • TotalSeq™-A0304 anti-mouse Hashtag 4

  • TotalSeq™-A0305 anti-mouse Hashtag 5

  • TotalSeq™-A0306 anti-mouse Hashtag 6

  • TotalSeq™-A0307 anti-mouse Hashtag 7

  • TotalSeq™-A0308 anti-mouse Hashtag 8

  • TotalSeq™-A0309 anti-mouse Hashtag 9

  • TotalSeq™-A0310 anti-mouse Hashtag 10

  • TotalSeq™-A0311 anti-mouse Hashtag 11

  • TotalSeq™-A0312 anti-mouse Hashtag 12

  • TotalSeq™-A0313 anti-mouse Hashtag 13

  • TotalSeq™-A0314 anti-mouse Hashtag 14

  • TotalSeq™-A0315 anti-mouse Hashtag 15

  • TotalSeq™-C0301 anti-mouse Hashtag 1

  • TotalSeq™-C0302 anti-mouse Hashtag 2

  • TotalSeq™-C0303 anti-mouse Hashtag 3

  • TotalSeq™-C0304 anti-mouse Hashtag 4

  • TotalSeq™-C0305 anti-mouse Hashtag 5

  • TotalSeq™-B0301 anti-mouse Hashtag 1

  • TotalSeq™-B0302 anti-mouse Hashtag 2

  • TotalSeq™-B0303 anti-mouse Hashtag 3

  • TotalSeq™-B0304 anti-mouse Hashtag 4

  • TotalSeq™-B0305 anti-mouse Hashtag 5

  • TotalSeq™-B0306 anti-mouse Hashtag 6

  • TotalSeq™-B0307 anti-mouse Hashtag 7

  • TotalSeq™-B0308 anti-mouse Hashtag 8

  • TotalSeq™-B0309 anti-mouse Hashtag 9

  • TotalSeq™-B0310 anti-mouse Hashtag 10

  • TotalSeq™-C0306 anti-mouse Hashtag 6

  • TotalSeq™-C0307 anti-mouse Hashtag 7

  • TotalSeq™-C0308 anti-mouse Hashtag 8

  • TotalSeq™-C0309 anti-mouse Hashtag 9

  • TotalSeq™-C0310 anti-mouse Hashtag 10

  • TotalSeq™-C0311 anti-mouse Hashtag 11

  • TotalSeq™-C0312 anti-mouse Hashtag 12

  • TotalSeq™-C0313 anti-mouse Hashtag 13

  • TotalSeq™-C0314 anti-mouse Hashtag 14

  • TotalSeq™-C0315 anti-mouse Hashtag 15

  • TotalSeq™-C0316 anti-mouse Hashtag 16

  • TotalSeq™-C0326 anti-mouse Hashtag 20

  • TotalSeq™-C0325 anti-mouse Hashtag 19

  • TotalSeq™-A0325 anti-mouse Hashtag 19

  • TotalSeq™-A0326 anti-mouse Hashtag 20

  • TotalSeq™-B0317 anti-mouse Hashtag 17

  • TotalSeq™-B0318 anti-mouse Hashtag 18

  • TotalSeq™-B0326 anti-mouse Hashtag 20

  • TotalSeq™-B0325 anti-mouse Hashtag 19

  • TotalSeq™-B0312 anti-mouse Hashtag 12

  • TotalSeq™-B0313 anti-mouse Hashtag 13

  • TotalSeq™-B0314 anti-mouse Hashtag 14

  • TotalSeq™-B0315 anti-mouse Hashtag 15

  • TotalSeq™-B0316 anti-mouse Hashtag 16

  • TotalSeq™-B0311 anti-mouse Hashtag 11

  • TotalSeq™-A0316 anti-mouse Hashtag 16

  • TotalSeq™-A0321 anti-mouse Hashtag 21

  • TotalSeq™-C0321 anti-mouse Hashtag 21

  • TotalSeq™-C0318 anti-mouse Hashtag 18

  • TotalSeq™-C0317 anti-mouse Hashtag 17

  • TotalSeq™-C0322 anti-mouse Hashtag 22

  • TotalSeq™-C0323 anti-mouse Hashtag 23

  • TotalSeq™-C0324 anti-mouse Hashtag 24

  • TotalSeq™-A0317 anti-mouse Hashtag 17

  • TotalSeq™-A0318 anti-mouse Hashtag 18

  • TotalSeq™-A0322 anti-mouse Hashtag 22

  • TotalSeq™-B0322 anti-mouse Hashtag 22

  • TotalSeq™-A0323 anti-mouse Hashtag 23

  • TotalSeq™-B0324 anti-mouse Hashtag 24

  • TotalSeq™-B0321 anti-mouse Hashtag 21

  • TotalSeq™-B0323 anti-mouse Hashtag 23

  • TotalSeq™-A0324 anti-mouse Hashtag 24

  • TotalSeq™-D0301 anti-mouse Hashtag 1

  • TotalSeq™-D0302 anti-mouse Hashtag 2

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account