Bulk Epitope and Nucleic Acid Sequencing (BEN-seq) Protocol

 

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

 

Commonly used abbreviations:
ADT: Antibody derived tags: Antibodies raised against a specific extracellular target which are conjugated to an oligo sequence with the same barcode used to quantify the expression of that target.
HTO: Hashtag oligonucleotides: A pair of antibodies raised against two different targets which are conjugated to an oligo sequence with the same barcode used to run multiple samples on one 10x lane. 

 

Reagent and Instrument List

 

For Cell Surface Staining:

• TotalSeq™-A Antibody-Oligo Conjugates
• Human TruStain FcX™ (Fc Receptor Blocking Solution) (BioLegend, Cat # 422301/422302)
• TruStain FcX™ PLUS (anti-mouse CD16/32) (BioLegend, Cat # 156603/156604)
• Cell Staining Buffer (BioLegend, Cat # 420201)

 

For Extraction and Library Preparation:

• Quantabio sparQ HiFi PCR Master Mix (2X) (Quantabio, Cat# 95192-250) or KAPA HiFi HotStart ReadyMix (2X) (Kapa Biosystems, Cat# KK2601)
• Quantabio sparQ PureMag Beads (Quantabio, Cat# 951960) or SPRIselect reagent (Beckman CoµLter, Cat# B23317)
• qScript cDNA Flex Kit (Quantabio, Cat# 95049-025)
• Hydrophilic Streptavidin Magnetic Beads (New England BioLabs, S1421S)
• Zymo RNA Clean and Concentrator Kit (Zymo Research, R1017)
• Zymo Quick RNA Whole Blood Kit (Zymo Research, R1201)
• 4200 Tapestation (Agilent Technologies, Cat# G2991A)
• DNA High Sensitivity D1000 and High Sensitivity D5000 (Agilent, Cat# 5067-5584/5067-5592)
• SI-PCR Primer (10µM stock) (See notes at the end of the protocol for further details on primer sequences)
• TotalSeq™-A RT Primer (100 µM) (See notes at the end of the protocol for further details on primer sequences.)
• TruSeq Small RNA RPIx (10µM Stock) (See notes at the end of the protocol for further details on primer sequences.)
• Hybridization oligo (6 µM stock) (See notes at the end of the protocol for further details on primer sequences.)
• DynaMag-2 (Thermo, 12321D)
• 6X Wash buffer (120mM Tris pH 8, 3.6M NaCl, 6mM EDTA) (User provided)
• 1X Wash buffer (Diluted from 6X Wash buffer)
• Elution Buffer (20 mM Tris pH 8) (User provided)
• Buffer EB (Qiagen, Cat# 19086)

 

Other essential reagents:

• Nuclease-free Water (Thermo Fisher, Cat# AM9937)
• Ethanol (Sigma, Cat# E7023-500ML)
• Nuclease-Free Pipette Tips (e.g. Thermo Fisher Scientific AM12650, AM12660 or equivalent)
• PCR Thermocycler (Bio-Rad, T100™ Thermal Cycler)
• Countess™ II FL Automated Cell Counter (ThermoFisher, Cat# AMQAF1000)

Researchers are advised to validate equivalent products when substituting for the above recommendations.

 

Protocol

I) Cell labeling with TotalSeq™-A Antibodies

 

1. Prepare single cell suspension following a suitable protocol.
2. Suspend cells at a concentration of 2.0x10⁷ cells/mL in staining buffer.
3. Assess cell viability of samples using the Countess II cell counter.
   1. If viability is ≤ 70%, live cell enrichment (e.g. by flow cytometry) is recommended.
4. Aliquot 50 µL of cells into 12 x 75mm tubes.  
5. Add either 5 µL of Human TruStain FcX™ Fc, or 0.5 µL of TruStain FcX™ PLUS (anti-mouse CD16/32) blocking reagent to cell suspension.
   Note: We do not recommend the use of dextran during blocking/staining. If you have any questions please contact BioLegend Technical Support.
6. Incubate for 10 min at 4°C.
7. While cells are incubating in Fc Block, prepare antibody pool using 1 µg (or titrated amounts) of each TotalSeq™-A antibody.
   1. If using our lyophilized TotalSeq™- A cocktails, follow reconstitution instructions provided with the antibody cocktail.
8. Centrifuge the antibody pool at 14,000xg at 2 – 8°C for 10 minutes before adding to the cells.
   Note: If antibody cocktail volume is less than 55 µL, add Cell Staining Buffer up to 55 µL, then centrifuge. You will then transfer 50µL of the reconstituted antibody to your cells for staining.
9. Carefully pipette out the liquid, avoiding the bottom of the tube, and add the TotalSeq-A™ antibody cocktail to the cell suspension.  
10. Incubate for 30 minutes at 4°C.
11. Add 3.5 mL of cell staining buffer, resuspend cell pellet, and spin for 5 minutes 400xg at 4°C. Repeat wash 2 more times for a total of 3 washes.
12. Transfer cell suspension to an Eppendorf tube and spin down at 400xg for 5 min.
13. Remove supernatant.

 

II) Nucleic acid purification

1. Resuspend cell pellet in 300 µL of 1X DNA/RNA Shield (supplied in Zymo Quick-RNA Whole Blood kit).
2. Purify nucleic acid with Zymo Quick-RNA Whole Blood kit following the pelleted cells protocol.
   Important Note: DO NOT perform the recommended DNase I treatment step as it will degrade the antibody oligonucleotides.
3. Elute product in 30 µl of H₂O as described in kit manual.
4. Transfer 20 µL of eluate to a separate Eppendorf tube.
5. Add 5 µL of 6X wash buffer.
6. Add 5 µL of Hybridization oligo (6 µM stock).
7. Vortex and heat in a PCR cycler at 68°C for 5 min followed by a 4°C hold.
8. During step 7, aliquot 90 µL streptavidin beads (Hydrophilic Streptavidin Magnetic Beads, 4 mg/mL stock) and wash 3 times with 200 µL 1X wash buffer.
9. Add Hybridization mixture from step 7 to the streptavidin beads in step 8 and resuspend.
10. Incubate for 10 min at RT (resuspend after 5 min).
11. Place the sample on magnet until solution clears.
12. Remove and save supernatant. This is your RNA sample; proceed with RNA extraction according to the protocol in the Zymo RNA Clean and Concentrator kit using the in-column DNAse I treatment.
    1. 10 ug of the resulting purified RNA can be used as input for an Illumina mRNA library kit (e.g. Illumina TruSeq® Stranded mRNA Library Prep (20020594) kit with Illumina – TruSeq RNA UD Indexes (20022371).
13. Wash beads twice with 30 µl 1X wash buffer.
14. Resuspend beads in 30.5 µL of Elution Buffer.
15. Heat samples for 2 minutes at 70°C, then cool to 25°C in a PCR cycler. 
16. Place sample on magnet until solution clears.
17. Transfer 30 µL of supernatant to a new tube strip.
18. Repeat steps 14-17 and combine the eluates for a total volume of 60 µL. This is your antibody-derived-tag (ADT) sample.

 

III) First strand synthesis

1. Setup priming template mixture:

Reagent	1 rxn (µl)
ADT eluate	10
TotalSeq™-A RT Primer (100 µM)	1
Total	11

 

 

2. Vortex and centrifuge for 10s to collect contents.
3. Incubate at 65°C for 5 min and hold at 4°C on PCR cycler.
4. Prepare the RT reaction mix with the primed template mixture:

Reagent	1 rxn (µl)
Primed template mixture	11
qScript Flex Reaction Mix (5X)	4
qScript Reverse Transcriptase	1
Nuclease-free water	4
Total	20

 

 

5. Vortex and centrifuge for 10 sec to collect contents.
6. Incubate in a thermal cycler with the following protocol.

Step	Temperature	Time
1	42°C	60 min
2	85°C	5 min
3	4°C	hold

 

 

7. Add 35 µL of SPRI beads and mix.
8. Incubate at RT for 5 min.
9. Place sample on magnet until solution clears.
10. Remove the supernatant.
11. Add 200 μl of 80% ethanol to the pellet while on the magnet. Wait 30 sec.
12. Remove the ethanol.
13. Add 200 μl of 80% ethanol to pellet. Wait 30 sec.
14. Remove the ethanol.
15. Centrifuge briefly. Place on the magnet.
16. Remove remaining ethanol. Air dry for 1 min.
17. Remove from the magnet. Immediately add 25.5 μl Buffer EB.
18. Mix by pipetting (pipette set to 25 μl) without introducing bubbles.
19. Incubate 2 min at room temperature.
20. Place on the magnet until the solution clears.
21. Transfer 25 μl sample to a new tube strip.

 

IV) Library Generation

22. Prepare the ADT library PCR mix.

Reagent	1 rxn (µl)
Purified ADTfraction	10
SI PCR primer (10uM)	2.5
RPIx Primer (10uM)	2.5
2X QuantaBio Hifi Master Mix	25
RNAse-free Water	10
Total	50

 

 

23. Incubate in a thermal cycler with the following protocol.

TotalSeq™-A ADT
98°C	2 min
98°C	20 sec	16 cycles
60°C	30 sec
72°C	20 sec
72°C	5 min
4°C	hold

 

 

24. Add 60 µl SPRIselect Reagent (1.2X) to each sample.
25. Incubate 5 min at room temperature.
26. Place on the magnet High until the solution clears.
27. Remove the supernatant.
28. Place tubes on magnet on High. Wash pellet twice with 200 µl 80% ethanol.
29. Centrifuge briefly. Place on the magnet Low. Remove remaining ethanol.
30. Remove from the magnet. Add 40.5 µl water.
31. Incubate 2 min at room temperature.
32. Place on the magnet Low until the solution clears.
33. Transfer 40 µl to a new tube strip. Store at 4°C for up to 72 h or at −20°C for long-term storage.
34. ADT libraries are now ready to be sequenced.

 

 

Notes:

 

Oligos required for ADT library amplification:
 

PAGE purification is the preferred method when ordering primers.
 

Hybridization Oligo:
5’-Biotin-AAAAAAAAAAAATGGAATTCTCGGGTGCCAAGG-3’

 

TotalSeq™-A RT Primer:
5'- CACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3'

 

SI-PCR Primer (Reverse): 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC*T*C-3'

 

RPI6 TotalSeq A (Forward): 5'-CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A-3'

RPI12 TotalSeq A (Forward): 5'-CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A-3'