Loading...

TotalSeq™-D0008 anti-human CD273 (B7-DC, PD-L2) Antibody

Pricing & Availability
Clone
24F.10C12 (See other available formats)
Regulatory Status
RUO
Other Names
B7-DC, PD-L2, PDL2, B7DC
Isotype
Mouse IgG2a, κ
Barcode Sequence
TCAACGCTTGGCTAG
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
329627 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD273, known as B7-DC, is also called programmed death ligand 2 (PDL2). This ligand is a 25 kD type I transmembrane protein and a member of B7 family within the immunoglobulin receptor superfamily and is expressed on a subset of dendritic cells, liver and a small subset of macrophages as well as a few transformed cell lines. CD273 has been reported to be stimulatory on dendritic cells when cross-linked and to inhibit T cell activation upon engaging the PD-1 receptor. CD273 has also been reported to bind to an alternative receptor and to mediate T cell activation through such non-PD1 mediated interactions.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human PD-L2 cDNA
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Brown JA, et al. 2003. J. Immunol. 170:1257
  2. Rodig N, et al. 2003. Eur. J. Immunol. 33:3117
RRID
AB_2892396 (BioLegend Cat. No. 329627)

Antigen Details

Structure
B7 Immunoglobulin superfamily, 25 kD
Distribution

Dendritic cells, liver, few transformed cell lines, subset of macrophages

Function
Binds to PD-1 and alternative receptor; ligation on DC stimulates, inhibits T cell responses via PD-1 binding, stimulates T cells via alternative receptor binding and promotes tumor immunity
Ligand/Receptor
PD-1
Cell Type
Dendritic cells, Macrophages
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Shin T, et al. 2003. J. Exp. Med. 198:31.
2. Liu X, et al. 2003. J. Exp. Med. 197:1721.
3. Carreno BM, et al. 2002. Annu. Rev. Immunol. 20:29.

Gene ID
80380 View all products for this Gene ID
UniProt
View information about CD273 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05.25.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account