TotalSeq™-D0063 anti-human CD45RA antibody, CD45RA, HI100

Pricing & Availability

Clone: HI100 (See other available formats)
Regulatory Status: RUO
Workshop: IV N906
Other Names: GP180, L-CA, LCA, LY5, T200, PTPRC
Isotype: Mouse IgG2b, κ
Barcode Sequence: TCAATCCTTCCGCTT
Ave. Rating: Submit a Review
Product Citations: publications

Compare all formats

Cat #

Size

Price

Quantity Check Availability

Save

304175

10 µg

296€

Check Availability

Need larger quantities of this item?
Request Bulk Quote

Description

CD45RA is a 205-220 kD single chain type I glycoprotein. It is an exon 4 splice variant of the tyrosine phosphatase CD45. The CD45RA isoform is expressed on resting/naïve T cells, medullary thymocytes, B cells and monocytes. CD45RA enhances both T cell receptor and B cell receptor signaling. CD45 non-covalently associates with lymphocyte phosphatase-associated phosphoprotein (LPAP) on T and B lymphocytes. CD45 has been reported to be associated with several other cell surface antigens including CD1, CD2, CD3, and CD4. CD45 has also been reported to bind galectin-1. CD45 isoform expression can change in response to cytokines.

Product Details

Technical Data Sheet (pdf)

Product Details

Verified Reactivity: Human
Reported Reactivity: Chimpanzee
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for relevant formats of this clone) include: inhibition of CD45 functions², immunohistochemical staining of frozen tissue sections³ and formalin-fixed paraffin-embedded tissue sections⁴, and immunocytochemistry^15,16.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.
RRID: AB_2892356 (BioLegend Cat. No. 304175)

Antigen Details

Structure: Tyrosine phosphatases, type I transmembrane (exon 4 splicing of CD45 gene), 205-220 kD
Distribution: B cells, naïve T cells, monocytes
Function: Enhances TCR and BCR signaling
Ligand/Receptor: Galectin-1, CD2, CD3, CD4
Cell Type: B cells, Monocytes, T cells, Tregs
Biology Area: Cell Biology, Immunology, Inhibitory Molecules, Neuroscience, Neuroscience Cell Markers
Molecular Family: CD Molecules
Antigen References: 1. Thomas M. 1989. Annu. Rev. Immunol. 7:339.
2. Trowbridge I, et al. 1994. Annu. Rev. Immunol.12:85.
Gene ID: 5788 View all products for this Gene ID
UniProt: View information about CD45RA on UniProt.org

Documentation

Reviews

Review This Product

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Related Pages & Pathways

Pathways

Stem Cells and Development

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD45RA Reagents Request Custom Conjugation

Description	Clone	Applications
APC anti-human CD45RA	HI100	FC
Biotin anti-human CD45RA	HI100	FC
FITC anti-human CD45RA	HI100	FC
PE anti-human CD45RA	HI100	FC,SB
PE/Cyanine5 anti-human CD45RA	HI100	FC
Purified anti-human CD45RA	HI100	FC,CyTOF®,ICC,IHC-P,IHC-F,SB
Alexa Fluor® 488 anti-human CD45RA	HI100	FC
Alexa Fluor® 647 anti-human CD45RA	HI100	FC,IHC-P
Pacific Blue™ anti-human CD45RA	HI100	FC
Alexa Fluor® 700 anti-human CD45RA	HI100	FC
PerCP/Cyanine5.5 anti-human CD45RA	HI100	FC,SB
PE/Cyanine7 anti-human CD45RA	HI100	FC
APC/Cyanine7 anti-human CD45RA	HI100	FC
Brilliant Violet 421™ anti-human CD45RA	HI100	FC,IHC-P
Brilliant Violet 570™ anti-human CD45RA	HI100	FC
Brilliant Violet 605™ anti-human CD45RA	HI100	FC
Brilliant Violet 650™ anti-human CD45RA	HI100	FC
Brilliant Violet 711™ anti-human CD45RA	HI100	FC
Brilliant Violet 785™ anti-human CD45RA	HI100	FC
Brilliant Violet 510™ anti-human CD45RA	HI100	FC
Purified anti-human CD45RA (Maxpar® Ready)	HI100	FC,CyTOF®
PE/Dazzle™ 594 anti-human CD45RA	HI100	FC
APC/Fire™ 750 anti-human CD45RA	HI100	FC
PerCP anti-human CD45RA	HI100	FC
FITC anti-human CD45RA	HI100	FC
TotalSeq™-A0063 anti-human CD45RA	HI100	PG
Alexa Fluor® 594 anti-human CD45RA	HI100	IHC-P
TotalSeq™-B0063 anti-human CD45RA	HI100	PG
TotalSeq™-C0063 anti-human CD45RA	HI100	PG
Brilliant Violet 750™ anti-human CD45RA	HI100	FC
Spark NIR™ 685 anti-human CD45RA	HI100	FC
APC anti-human CD45RA	HI100	FC
PE/Fire™ 640 anti-human CD45RA	HI100	FC
PE/Fire™ 700 anti-human CD45RA Antibody	HI100	FC
Spark YG™ 581 anti-human CD45RA	HI100	FC
TotalSeq™-D0063 anti-human CD45RA	HI100	PG
Spark Violet™ 423 anti-human CD45RA	HI100	FC,IHC-P
GMP FITC anti-human CD45RA	HI100	FC
PE/Cyanine7 anti-human CD45RA	HI100	FC
PE/Dazzle™ 594 anti-human CD45RA	HI100	FC
APC/Fire™ 750 anti-human CD45RA	HI100	FC
Spark UV™ 387 anti-human CD45RA	HI100	FC
GMP APC anti-human CD45RA	HI100	FC
TotalSeq™-Bn0063 anti-human CD45RA	HI100	SB
Spark Blue™ 550 anti-human CD45RA	HI100	FC
GMP PE/Dazzle™ 594 anti-human CD45RA	HI100	FC
GMP APC/Fire™ 750 anti-human CD45RA	HI100	FC
Spark PLUS UV395™ anti-human CD45RA	HI100	FC
Spark Red™ 718 anti-human CD45RA	HI100	FC
APC/Fire™ 810 anti-human CD45RA	HI100	FC
PE/Fire™ 810 anti-human CD45RA	HI100	FC
Spark Blue™ 574 anti-human CD45RA (Flexi-Fluor™)	HI100	FC

Certificate of Analysis

Go To Top Version: 1 Revision Date: 06.29.2021

For Research Use Only. Not for diagnostic or therapeutic use.

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.