IMPORTANT NOTICE: Our email addresses will soon change. Learn more >>

TotalSeq™-D0072 anti-human CD4 Antibody

Pricing & Availability
Clone
RPA-T4 (See other available formats)
Regulatory Status
RUO
Workshop
IV T114
Other Names
T4
Isotype
Mouse IgG1, κ
Barcode Sequence
TGTTCCCGCTCAACT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
300575 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD4, also known as T4, is a 55 kD single-chain type I transmembrane glycoprotein expressed on most thymocytes, a subset of T cells, and monocytes/macrophages. CD4, a member of the Ig superfamily, recognizes antigens associated with MHC class II molecules, and participates in cell-cell interactions, thymic differentiation, and signal transduction. CD4 acts as a primary receptor for HIV, binding to HIV gp120. CD4 has also been shown to interact with IL-16.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
Chimpanzee
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The RPA-T4 antibody binds to the D1 domain of CD4 (CDR1 and CDR3 epitopes) and can block HIV gp120 binding and inhibit syncytia formation. Additional reported applications (for the relevant formats) include: immunohistochemistry of acetone-fixed frozen sections3,4,5, blocking of T cell activation1,2, and spatial biology (IBEX)10,11.  This clone was tested in-house and does not work on formalin fixed paraffin-embedded (FFPE) tissue. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 300569 - 300574).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York. (Activ)
  2. Moir S, et al. 1999. J. Virol. 73:7972. (Activ)
  3. Deng MC, et al. 1995. Circulation 91:1647. (IHC)
  4. Friedman T, et al. 1999. J. Immunol. 162:5256. (IHC)
  5. Mack CL, et al. 2004. Pediatr. Res. 56:79. (IHC)
  6. Lan RY, et al. 2006. Hepatology 43:729.
  7. Zenaro E, et al. 2009. J. Leukoc. Biol. 86:1393. (FC) PubMed
  8. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  9. Stoeckius M, et al. 2017. Nat. Methods. 14:865. (PG)
  10. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  11. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID
AB_2892343 (BioLegend Cat. No. 300575)

Antigen Details

Structure
Ig superfamily, type I transmembrane glycoprotein, 55 kD
Distribution

T cell subset, majority of thymocytes, monocytes/macrophages

Function
MHC class II co-receptor, lymphocyte adhesion, thymic differentiation, HIV receptor
Ligand/Receptor
MHC class II molecules, HIV gp120, IL-16
Cell Type
Dendritic cells, Macrophages, Monocytes, T cells, Thymocytes, Tregs
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Center D, et al. 1996. Immunol. Today 17:476.
2. Gaubin M, et al. 1996. Eur. J. Clin. Chem. Clin. Biochem. 34:723.

Gene ID
920 View all products for this Gene ID
UniProt
View information about CD4 on UniProt.org

Related FAQs

I am unable to see expression of T cell markers such as CD3 and CD4 post activation.
TCR-CD3 complexes on the T-lymphocyte surface are rapidly downregulated upon activation with peptide-MHC complex, superantigen or cross-linking with anti-TCR or anti-CD3 antibodies. PMA/Ionomycin treatment has been shown to downregulate surface CD4 expression. Receptor downregulation is a common biological phenomenon and so make sure that your stimulation treatment is not causing it in your sample type.

Other Formats

View All CD4 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD4 RPA-T4 FC
Biotin anti-human CD4 RPA-T4 FC
FITC anti-human CD4 RPA-T4 FC,SB
PE anti-human CD4 RPA-T4 FC
PE/Cyanine5 anti-human CD4 RPA-T4 FC
PE/Cyanine7 anti-human CD4 RPA-T4 FC
Purified anti-human CD4 RPA-T4 FC,CyTOF®,Activ,Block,IHC
APC/Cyanine7 anti-human CD4 RPA-T4 FC
Alexa Fluor® 488 anti-human CD4 RPA-T4 FC,ICC
Alexa Fluor® 647 anti-human CD4 RPA-T4 FC,SB
Pacific Blue™ anti-human CD4 RPA-T4 FC
Brilliant Violet 421™ anti-human CD4 RPA-T4 FC,ICC
Alexa Fluor® 700 anti-human CD4 RPA-T4 FC,SB
PerCP anti-human CD4 RPA-T4 FC
PerCP/Cyanine5.5 anti-human CD4 RPA-T4 FC
Brilliant Violet 570™ anti-human CD4 RPA-T4 FC
Brilliant Violet 650™ anti-human CD4 RPA-T4 FC
Purified anti-human CD4 (Maxpar® Ready) RPA-T4 FC,CyTOF®
Alexa Fluor® 594 anti-human CD4 RPA-T4 FC,ICC
Brilliant Violet 510™ anti-human CD4 RPA-T4 FC
PE/Dazzle™ 594 anti-human CD4 RPA-T4 FC
Brilliant Violet 785™ anti-human CD4 RPA-T4 FC
Brilliant Violet 605™ anti-human CD4 RPA-T4 FC
Brilliant Violet 711™ anti-human CD4 RPA-T4 FC
APC/Fire™ 750 anti-human CD4 RPA-T4 FC
CD4 Fluorophore Sampler Kit RPA-T4 FC
CD4 Fluorophore Sampler Kit with Veri-Cells™ PBMC RPA-T4 FC
TotalSeq™-A0072 anti-human CD4 RPA-T4 PG
TotalSeq™-B0072 anti-human CD4 RPA-T4 PG
TotalSeq™-C0072 anti-human CD4 RPA-T4 PG
Ultra-LEAF™ Purified anti-human CD4 RPA-T4 FC,CyTOF®,Activ,Block,IHC
TotalSeq™-D0072 anti-human CD4 RPA-T4 PG
Go To Top Version: 1    Revision Date: 05.24.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account