- Clone
- BC96 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V T-072
- Other Names
- Low affinity IL-2R, IL-2R α chain, Tac, p55
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TTTGTCCTGTACGCC
- Ave. Rating
- Submit a Review
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
302651 | 10 µg | 296€ |
CD25 is a 55 kD type I transmembrane glycoprotein also known as the low affinity IL-2 receptor α chain or Tac. It is expressed on progenitor lymphocytes, activated T and B cells, and activated monocytes/macrophages. CD25 is also expressed on a subset of non-stimulated CD4+ T cells termed T regulatory cells. CD25 associates with the IL-2 receptor β (CD122) and common γ chains (CD132) to form the high affinity IL-2R complex.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Baboon, Chimpanzee, Cynomolgus, Pigtailed Macaque, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications include: immunocytochemistry3.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) - RRID
-
AB_2892350 (BioLegend Cat. No. 302651)
Antigen Details
- Structure
- Type I transmembrane glycoprotein, 55 kD
- Distribution
-
Activated T cells and B cells, monocytes/macrophages, Treg
- Function
- Associates with IL-2 receptor β (CD122) and γ chains (CD132) to form high affinity IL-2R complex
- Ligand/Receptor
- IL-2
- Cell Type
- B cells, Macrophages, Monocytes, T cells, Tregs
- Biology Area
- Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
1. Taniguchi T, et al. 1993. Cell 73:5.
2. Waldmann T. 1991. J. Biol. Chem. 266:2681. - Gene ID
- 3559 View all products for this Gene ID
- UniProt
- View information about CD25 on UniProt.org
Related Products
Description | Clone | Applications |
---|---|---|
Cell Staining Buffer | FC,ICC,ICFC | |
RBC Lysis Buffer (10X) | FC | |
Human TruStain FcX™ (Fc Receptor Blocking Solution) | FC,ICC,ICFC | |
Lymphopure™ | Cell Sep - Pos,Cell Sep - Neg |
Related FAQs
Other Formats
View All CD25 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD25
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
FITC anti-human CD25
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
PE anti-human CD25
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
PE/Cyanine5 anti-human CD25
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
Purified anti-human CD25
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
APC/Cyanine7 anti-human CD25
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
PE/Cyanine7 anti-human CD25
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
Alexa Fluor® 488 anti-human CD25
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
Alexa Fluor® 647 anti-human CD25
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
Pacific Blue™ anti-human CD25
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
Alexa Fluor® 700 anti-human CD25
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
Biotin anti-human CD25
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
PerCP/Cyanine5.5 anti-human CD25
PHA-stimulated (day 3) human peripheral blood lymphocytes we... -
Brilliant Violet 421™ anti-human CD25
Human peripheral blood lymphocytes were stained with CD4 FIT... -
Brilliant Violet 605™ anti-human CD25
Human peripheral blood lymphocytes were stained with CD4 FIT... -
Brilliant Violet 650™ anti-human CD25
Human peripheral blood lymphocytes were stained with CD4 FIT... -
Brilliant Violet 711™ anti-human CD25
Human peripheral blood lymphocytes were stained with CD4 FIT... -
Brilliant Violet 785™ anti-human CD25
Human peripheral blood lymphocytes were stained with CD4 FIT... -
Brilliant Violet 510™ anti-human CD25
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
APC/Fire™ 750 anti-human CD25
PHA-stimulated (day 4) human peripheral blood lymphocytes we... -
TotalSeq™-A0085 anti-human CD25
-
PE/Dazzle™ 594 anti-human CD25
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
TotalSeq™-B0085 anti-human CD25
-
TotalSeq™-C0085 anti-human CD25
-
TotalSeq™-D0085 anti-human CD25
-
APC/Fire™ 810 anti-human CD25 Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Fire™ 640 anti-human CD25
Human peripheral blood lymphocytes were stained with anti-hu...
Follow Us