TotalSeq™-D0087 anti-human CD45RO Antibody

Pricing & Availability
Clone
UCHL1 (See other available formats)
Regulatory Status
RUO
Workshop
IV N31
Other Names
CD45RO
Isotype
Mouse IgG2a, κ
Barcode Sequence
CTCCGAATCATGTTG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
304265 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD45RO is a 180 kD single chain membrane glycoprotein. It is a splice variant of tyrosine phosphatase CD45, lacking the A, B, and C determinants. The CD45RO isoform is expressed on activated and memory T cells, some B cell subsets, activated monocytes/macrophages, and granulocytes. CD45RO enhances both T cell receptor and B cell receptor signaling mediated activation. CD45 and its isoforms non-covalently associate with lymphocyte phosphatase-associated phosphoprotein (LPAP) on T and B lymphocytes. CD45 has been reported to be associated with several other cell surface antigens including CD1, CD2, CD3, and CD4. CD45 has also been reported to bind galectin-1 and CD22. CD45 isoform expression can change in response to cytokines.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
Chimpanzee, Cynomolgus, Common Marmoset
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
IL-2 dependent T cell line, CA1
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

 


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The UCHL1 antibody is commonly used in combination with antibodies against CD45RA to discern memory and naïve T cells. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections5 and formalin-fixed paraffin-embedded tissue sections4, Western blotting2, and immunoprecipitation3.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Knapp W, et al. Eds. 1989. Leucocyte Typing IV. Oxford University Press. New York. (FC)
  2. Ishii T, et al. 2001. P. Natl. Acad. Sci. USA 98:12138. (WB)
  3. Ponsford M, et al. 2001. Clin. Exp. Immunol. 124:315. (IP)
  4. Yamada M, et al. 1996. Stroke 27:1155. (IHC)
  5. Sakkas LI, et al. 1998. Clin. Diagn. Lab. Immunol. 5:430. (IHC)
  6. Baba N, et al. 2010. Int. Immunol. 22:237. PubMed
  7. Thakral D, et al. 2008. J. Immunol. 180:7431. (FC) PubMed
  8. Weiss L, et al. 2010. P. Natl. Acad. Sci. USA 107:10632. PubMed
  9. Wu YY, et al. 2007. Infect. Immun. 75:4357. PubMed
  10. Mozaffarian N, et al. 2008. Rheumatology 47:1335. PubMed
  11. Roque S, et al. 2007. J. Immunol. 178:8028. PubMed
  12. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  13. Smith SH, et al. 1986. Immunology 58:63. (Immunogen)
  14. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
RRID
AB_2894611 (BioLegend Cat. No. 304265)

Antigen Details

Structure
Tyrosine phosphatases, type I transmembrane, 180 kD (isoform of CD45 containing none of the A, B, or C determinants)
Distribution

Activated and memory T cells, B cell subsets, monocytes, macrophages, granulocytes

Function
Enhances TCR and BCR signaling
Ligand/Receptor
CD22
Cell Type
B cells, Granulocytes, Macrophages, Mesenchymal Stem Cells, Monocytes, T cells, Tregs
Biology Area
Cell Biology, Immunology, Inhibitory Molecules, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family
CD Molecules
Antigen References

1. Thomas M. 1989. Annu. Rev. Immunol. 7:339.
2. Trowbridge I, et al. 1994. Annu. Rev. Immunol. 12:85.

Gene ID
5788 View all products for this Gene ID
UniProt
View information about CD45RO on UniProt.org

Other Formats

View All CD45RO Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD45RO UCHL1 FC
FITC anti-human CD45RO UCHL1 FC
PE anti-human CD45RO UCHL1 FC,SB
PE/Cyanine5 anti-human CD45RO UCHL1 FC
Purified anti-human CD45RO UCHL1 FC,WB,IP,IHC-P,SB
Alexa Fluor® 488 anti-human CD45RO UCHL1 FC,IHC-P
Pacific Blue™ anti-human CD45RO UCHL1 FC
Alexa Fluor® 700 anti-human CD45RO UCHL1 FC
Biotin anti-human CD45RO UCHL1 FC
Brilliant Violet 421™ anti-human CD45RO UCHL1 FC,IHC-P
PerCP/Cyanine5.5 anti-human CD45RO UCHL1 FC
Brilliant Violet 570™ anti-human CD45RO UCHL1 FC
Brilliant Violet 605™ anti-human CD45RO UCHL1 FC
APC/Cyanine7 anti-human CD45RO UCHL1 FC
PE/Cyanine7 anti-human CD45RO UCHL1 FC
Brilliant Violet 650™ anti-human CD45RO UCHL1 FC
Brilliant Violet 711™ anti-human CD45RO UCHL1 FC
Brilliant Violet 785™ anti-human CD45RO UCHL1 FC
Alexa Fluor® 594 anti-human CD45RO UCHL1 IHC-P
Purified anti-human CD45RO (Maxpar® Ready) UCHL1 FC,CyTOF®
Brilliant Violet 510™ anti-human CD45RO UCHL1 FC
PE/Dazzle™ 594 anti-human CD45RO UCHL1 FC
APC/Fire™ 750 anti-human CD45RO UCHL1 FC
PerCP anti-human CD45RO UCHL1 FC
APC anti-human CD45RO UCHL1 FC
TotalSeq™-A0087 anti-human CD45RO UCHL1 PG
TotalSeq™-B0087 anti-human CD45RO UCHL1 PG
TotalSeq™-C0087 anti-human CD45RO UCHL1 PG
Brilliant Violet 750™ anti-human CD45RO UCHL1 FC
PE/Fire™ 640 anti-human CD45RO UCHL1 FC
TotalSeq™-D0087 anti-human CD45RO UCHL1 PG
Spark Violet™ 423 anti-human CD45RO UCHL1 FC
GMP APC anti-human CD45RO UCHL1 FC
PE anti-human CD45RO UCHL1 FC
TotalSeq™-Bn1369 anti-human CD45RO UCHL1 SB
GMP PE anti-human CD45RO UCHL1 FC
Spark UV™ 387 anti-human CD45RO UCHL1 FC
APC/Fire™ 810 anti-human CD45RO UCHL1 FC
Go To Top Version: 1    Revision Date: 07.21.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account