TotalSeq™-D0129 anti-human CD140b (PDGFRβ) Antibody

Pricing & Availability
Clone
18A2 (See other available formats)
Regulatory Status
RUO
Other Names
Platelet-derived growth factor receptor, beta polypeptide, PDGFR1, PDGFRβ, PDGFRb, PDGF receptor beta
Isotype
Mouse IgG1, κ
Barcode Sequence
CAATGGTTCACTGCC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
323613 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD140b is a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. The identity of the growth factor bound to the receptor determines whether the functional receptor is a homodimer or heterodimer composed of both PDGFR-α and -β. CD140b contains two immunoglobulin-like domains and a tyrosine kinase domain with a predicted molecular weight approximately 124 kD. CD140b is widely expressed on a variety of mesenchymal-derived cells and is preferentially expressed on some tumors such as medulloblastoma. Binding of B-chain containing PDGF molecules can stimulate cell proliferation. CD140b has been shown to interact with a number of kinases (including Raf-1, NCK1, FAK, Fyn, others) as well as adaptor molecules and signaling intermediates (Crk, Grb2, Grb4, RasGAP, SHP2, SHC1, others), and has also been shown to associate with integrin β3 and nexin sorting molecules. CD140b has been implicated in several disease states including atherogenesis and oncogenesis. The PDGFRβ is heavily phosphorylated on numerous tyrosine residues through both autophosphorylation and ligand-dependent processes. 

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
NIH-3T3 cells transfected with human PDGFRbeta
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The 18A2 monclonal antibody recognizes human CD140b also known as the platelet-derived growth factor receptor, beta polypeptide, PDGFR1, and PDGFRß. It has been shown to be useful for flow cytometric detection of CD140b.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Vogel W, et al. 2002. Haematologica 88:126.
  2. Arima, S., et al 2011. Development. 138:4763. PubMed.
RRID
AB_2941491 (BioLegend Cat. No. 323613)

Antigen Details

Structure
Cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. The identity of the growth factor bound to the receptor determines whether the functional receptor is a homodimer or heterodimer composed of both PDGFR1 and PD
Distribution

Widely expressed on a variety of mesenchymal-derived cells. Preferentially expressed in medulloblastoma.

Function
Stimulation of cell proliferation; mitogenic activity for cells of mesenchymal origin. Has been implicated in atherogenesis and oncogenesis.
Interaction
Interacts with a number of kinases (including Raf-1, NCK1, FAK, Fyn, others) as well as adaptor molecules and signaling intermediates (Grb2, Grb4, RasGAP, SHP2, SHC1, Crk, others). Has also been shown to associate with integrin β3 and nexin sorting m
Ligand/Receptor
Binds to B-chain containing PDGF molecules as well as protease-activated PDGF-C
Modification
Multiple tyrosine phosphorylation sites (Y549, Y581, Y716, Y740, Y751, Y763, Y771, Y775, Y857, Y1009, Y1021)
Cell Type
Embryonic Stem Cells, Mesenchymal cells, Mesenchymal Stem Cells
Biology Area
Angiogenesis, Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Claesson-Welsh L, et al. 1988. Mol. Cell Biol. 8:3476.
2. Gronwald RG, et al. 1988. Proc. Natl. Acad. Sci. USA 85:3435.
3. Gilbertson DG, et al. 2001. J. Biol. Chem.276:27406.
4. Seifert RA, et al. 1989. J. Biol. Chem. 264:8771.
5. Kanakaraj P, et al. 1991. Biochemistry 30:1761.

Gene ID
5159 View all products for this Gene ID
UniProt
View information about CD140b on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 04.11.2023

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account