- Clone
- AY13 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Proto-oncogene c-ErbB-1, Receptor tyrosine-protein kinase erbB-1, HER1
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GCTTAACATTGGCAC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
352935 | 10 µg | 296€ |
Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein and member of the protein kinase superfamily that regulates cell growth and differentiation. EGFR binds EGF, TGF-α, amphiregulin, betacellulin, heparin-binding EGF-like growth factor, GP30, and vaccinia virus growth factor - all members of the EGF family. Ligand binding induces EGFR dimerization and autophosphorylation, initiating the MAPK, Akt, and JNK signaling pathways. EGFR is expressed by epithelial and endothelial cells and is frequently expressed by epithelial carcinomas.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Non-small cell lung cancer (NSCLC) cell line NCI-H322
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Yamaguchi M, et al. 2009. The 15th Annual Meeting Japan Society of Gene Therapy. p1056. Abstract 92.
- RRID
-
AB_2941532 (BioLegend Cat. No. 352935)
Antigen Details
- Structure
- Member of the protein kinase superfamily; transmembrane glycoprotein; ligand binding induces dimerization and autophosphorylation
- Distribution
-
Epithelial cells and endothelial cells; frequently found in epithelial carcinomas
- Function
- Controls cell growth and differentiation
- Interaction
- MAPK, Akt, JNK
- Ligand/Receptor
- Members of the epidermal growth factor (EGF) family such as EGF, TGF-α, amphiregulin, betacellulin, heparin-binding EGF-like growth factor, GP30 and vaccinia virus growth factor
- Cell Type
- Endothelial cells, Epithelial cells
- Biology Area
- Cell Biology, Cell Cycle/DNA Replication, Immunology, Innate Immunity, Neuroscience, Synaptic Biology
- Molecular Family
- CD Molecules, Growth Factors
- Antigen References
-
1. da Cunha Santos G, et al. 2011. Annu. Rev. Pathol. 6:49.
2. Gusterson BA and Hunter KD. 2009. Lancet Oncol. 10:522.
3. Mano M and Humblet Y. 2008. Nat. Clin. Pract. Oncol. 5:415.
4. Pao W and Chmielecki J. 2010. Nat. Rev. Cancer 10:760. - Gene ID
- 1956 View all products for this Gene ID
- UniProt
- View information about EGFR on UniProt.org
Related FAQs
Other Formats
View All EGFR Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human EGFR
-
PE anti-human EGFR
-
APC anti-human EGFR
-
Alexa Fluor® 488 anti-human EGFR
-
Brilliant Violet 421™ anti-human EGFR
-
PE/Cyanine7 anti-human EGFR
-
PerCP/Cyanine5.5 anti-human EGFR
-
Alexa Fluor® 594 anti-human EGFR
-
Alexa Fluor® 647 anti-human EGFR
-
Brilliant Violet 711™ anti-human EGFR
-
PE/Dazzle™ 594 anti-human EGFR
-
TotalSeq™-A0132 anti-human EGFR
-
Brilliant Violet 605™ anti-human EGFR
-
APC/Fire™ 750 anti-human EGFR
-
TotalSeq™-B0132 anti-human EGFR
-
TotalSeq™-C0132 anti-human EGFR
-
Biotin anti-human EGFR
-
TotalSeq™-D0132 anti-human EGFR
-
Brilliant Violet 510™ anti-human EGFR
-
Brilliant Violet 650™ anti-human EGFR
-
Brilliant Violet 785™ anti-human EGFR
-
Spark Red™ 718 anti-human EGFR (Flexi-Fluor™)
-
Spark Blue™ 574 anti-human EGFR (Flexi-Fluor™)
-
Spark Blue™ 550 anti-human EGFR (Flexi-Fluor™)
Follow Us