TotalSeq™-D0148 anti-human CD197 (CCR7) Antibody

Pricing & Availability
Clone
G043H7 (See other available formats)
Regulatory Status
RUO
Other Names
BLR2, CDw197, EBI1, CMKBR7
Isotype
Mouse IgG2a, κ
Barcode Sequence
AGTTCAGTCAACCGA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
353267 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CCR7, also known as CD197, is a chemokine receptor that binds CCL19 and CCL21. CCR7 and its ligands link innate and adaptive immunity by affecting interactions between T cells and dendritic cells and their downstream effect. Naïve T cells enter the lymph node through high endothelial venules, which express CCL21. Dendritic cells and macrophages enter the lymph node through afferent lymphatics. The encounter of T cells and dendritic cells in the T cell zone is CCR7-dependent. In addition, during immunological surveillance, B cells recirculate between B-cell-rich compartments (follicles or B cell zones) in secondary lymphoid organs, surveying for antigen. After antigen binding, B cells move to the boundary of B and T zones to interact with T-helper cells; this B cell migration is directed by CCR7 and its ligands. CCR7-positive cancer cell expression has been associated with lymph node metastasis.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
CCR7-transfected cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2894573 (BioLegend Cat. No. 353267)

Antigen Details

Structure
Chemokine receptor, G protein-coupled receptors (GPCR), seven transmembrane receptor.
Distribution

T cells, B cells, NK, dendritic cells.

Function
The chemokine receptor CCR7 plays a pivotal role in the homing of naïve T cells and regulatory T cells to secondary lymphoid organs, and the migration of dendritic cells into afferent lymphatic vessels.
Ligand/Receptor
CCL19 and CCL21.
Cell Type
B cells, Dendritic cells, NK cells, T cells
Biology Area
Immunology
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References

1. Yanagihara S, et al. 1998. J. Immunol. 161:3096.
2. Charo IF, et al. 2006. N. Engl. J. Med. 354:610.
3. Reif K, et al. 2002. Nature 416:94.
4. Nakata B, et al. 2008. Oncology 74:69.
5. Brodie T. et al. 2013. Cytometry A. 6: 530-2. PubMed
6. Graves A.J. et al. 2014. Cytometry A. 7: 576–9 PubMed
7. Moncunill G. et al. 2014. Cytometry A. 12: 995-8 PubMed

Gene ID
1236 View all products for this Gene ID
UniProt
View information about CD197 on UniProt.org

Related FAQs

Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?

Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.

Other Formats

View All CD197 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD197 (CCR7) G043H7 FC
Alexa Fluor® 488 anti-human CD197 (CCR7) G043H7 FC
Brilliant Violet 421™ anti-human CD197 (CCR7) G043H7 FC
PE anti-human CD197 (CCR7) G043H7 FC
APC/Cyanine7 anti-human CD197 (CCR7) G043H7 FC
Pacific Blue™ anti-human CD197 (CCR7) G043H7 FC
APC anti-human CD197 (CCR7) G043H7 FC
FITC anti-human CD197 (CCR7) G043H7 FC
Alexa Fluor® 647 anti-human CD197 (CCR7) G043H7 FC
PerCP/Cyanine5.5 anti-human CD197 (CCR7) G043H7 FC
Brilliant Violet 605™ anti-human CD197 (CCR7) G043H7 FC
PE/Cyanine7 anti-human CD197 (CCR7) G043H7 FC
Brilliant Violet 711™ anti-human CD197 (CCR7) G043H7 FC
Brilliant Violet 785™ anti-human CD197 (CCR7) G043H7 FC
Brilliant Violet 510™ anti-human CD197 (CCR7) G043H7 FC
Brilliant Violet 650™ anti-human CD197 (CCR7) G043H7 FC
PE/Dazzle™ 594 anti-human CD197 (CCR7) G043H7 FC
Biotin anti-human CD197 (CCR7) G043H7 FC
Purified anti-human CD197 (CCR7) (Maxpar® Ready) G043H7 FC,CyTOF®
PerCP anti-human CD197 (CCR7) G043H7 FC
Alexa Fluor® 700 anti-human CD197 (CCR7) G043H7 FC
APC/Fire™ 750 anti-human CD197 (CCR7) G043H7 FC
TotalSeq™-A0148 anti-human CD197 (CCR7) G043H7 PG
TotalSeq™-B0148 anti-human CD197 (CCR7) G043H7 PG
TotalSeq™-C0148 anti-human CD197 (CCR7) G043H7 PG
Brilliant Violet 750™ anti-human CD197 (CCR7) G043H7 FC
Ultra-LEAF™ Purified anti-human CD197 (CCR7) G043H7 FC,Block
Spark NIR™ 685 anti-human CD197 (CCR7) G043H7 FC
KIRAVIA Blue 520™ anti-human CD197 (CCR7) G043H7 FC
PE/Fire™ 640 anti-human CD197 (CCR7) G043H7 FC
Spark YG™ 581 anti-human CD197 (CCR7) G043H7 FC
APC/Fire™ 810 anti-human CD197 (CCR7) Antibody G043H7 FC
TotalSeq™-D0148 anti-human CD197 (CCR7) G043H7 PG
PE/Fire™ 810 anti-human CD197 (CCR7) Antibody G043H7 FC
PE/Cyanine5 anti-human CD197 (CCR7) G043H7 FC
Spark YG™ 593 anti-human CD197 (CCR7) G043H7 FC
PE/Fire™ 744 anti-human CD197 (CCR7) G043H7 FC
Spark Red™ 718 anti-human CD197 (CCR7) (Flexi-Fluor™) G043H7 FC
Spark Red™ 718 anti-human CD197 (CCR7) G043H7 FC
Spark PLUS UV™ 395 anti-human CD197 (CCR7) G043H7 FC
Go To Top Version: 1    Revision Date: 05.26.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account