- Clone
- NK92.39 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Tactile (T cell-activated increased late expression)
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TGGCCTATAAATGGT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
338427 | 10 µg | 296€ |
CD96, known as TACTILE (T cell-activated increased late expression), is a 160 kD type I transmembrane glycoprotein and is a member of the Ig superfamily molecules. It is expressed on NK cells, T cells (up-regulated upon activation), and some acute myeloid leukemia (AML) cells, but not on normal B and myeloid cells. A soluble form of CD96 has been found in serum. CD96 is involved in T- and NK-cell adhesion through interaction with its ligand, CD155 (polio virus receptor).
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications include: block interaction of CD96 with PVR and functional assay
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Fuchs A, et al. 2004. J. Immunol. 172:3994
- Manes TD, et al. 2011. J. Immunol. 186:1763. PubMed
- RRID
-
AB_2936566 (BioLegend Cat. No. 338427)
Antigen Details
- Structure
- 160 kD, type I transmembrane protein, Ig superfamily
- Distribution
-
NK cells, T cells (upregulated upon activation)
- Ligand/Receptor
- CD155 (PVR)
- Cell Type
- NK cells, T cells
- Biology Area
- Immunology, Inhibitory Molecules, Innate Immunity
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. A John Wiley & Sons Inc, Publication
2. Hosen N, et al. 2007. Proc. Natl. Acad. Sci. USA 104:11008
3. Gong J, et al. 2008. Clin. Exp. Immunol. - Gene ID
- 10225 View all products for this Gene ID
- UniProt
- View information about CD96 on UniProt.org
Related FAQs
Other Formats
View All CD96 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD96 (TACTILE) | NK92.39 | FC,FA |
PE anti-human CD96 (TACTILE) | NK92.39 | FC |
APC anti-human CD96 (TACTILE) | NK92.39 | FC |
PerCP/Cyanine5.5 anti-human CD96 (TACTILE) | NK92.39 | FC |
PE/Dazzle™ 594 anti-human CD96 (TACTILE) | NK92.39 | FC |
Brilliant Violet 421™ anti-human CD96 (TACTILE) | NK92.39 | FC |
PE/Cyanine7 anti-human CD96 (TACTILE) | NK92.39 | FC |
TotalSeq™-A0175 anti-human CD96 (TACTILE) | NK92.39 | PG |
TotalSeq™-C0175 anti-human CD96 (TACTILE) | NK92.39 | PG |
Ultra-LEAF™ Purified anti-human CD96 (TACTILE) | NK92.39 | FC,FA |
TotalSeq™-B0175 anti-human CD96 (TACTILE) | NK92.39 | PG |
TotalSeq™-D0175 anti-human CD96 (TACTILE) | NK92.39 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD96 (TACTILE)
-
PE anti-human CD96 (TACTILE)
-
APC anti-human CD96 (TACTILE)
-
PerCP/Cyanine5.5 anti-human CD96 (TACTILE)
-
PE/Dazzle™ 594 anti-human CD96 (TACTILE)
-
Brilliant Violet 421™ anti-human CD96 (TACTILE)
-
PE/Cyanine7 anti-human CD96 (TACTILE)
-
TotalSeq™-A0175 anti-human CD96 (TACTILE)
-
TotalSeq™-C0175 anti-human CD96 (TACTILE)
-
Ultra-LEAF™ Purified anti-human CD96 (TACTILE)
-
TotalSeq™-B0175 anti-human CD96 (TACTILE)
-
TotalSeq™-D0175 anti-human CD96 (TACTILE)
Follow Us