- Clone
- S-HCL-1 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- BL-CAM, Siglec-2, Lyb8
- Isotype
- Mouse IgG2b, κ
- Barcode Sequence
- GGGTTGTTGTCTTTG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
363525 | 10 µg | 296€ |
CD22 is a 130 kD type I transmembrane glycoprotein also known as Siglec-2 and BL-CAM and is a member of the immunoglobulin superfamily (sialoadhesion subgroup). CD22 is expressed in the cytoplasm of pro-B and pre-B cells, and on the surface of mature B and activated B cells, but not on plasma cells. CD22 is present in the B cell receptor complex and associates with SHP-1, Syk, Lck, Lyn, and phospholipase Cγ1. A primary function of CD22 is thought to be in limiting antigen receptor signaling by modulating B cell activation threshold. CD22 has been shown to bind to CD45RO and CD75, although the natural ligands for this molecule remain controversial.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Nitschke L. 2005. Curr. Opin. Immunol. 17:290
- Foon Ka, et al. 1986. Blood. 68:297
- Schwarting R, et al. 1985. Blood. 65:974
- Campana D, et al. 1985. J. Immunol. 134:1524
- RRID
-
AB_2894556 (BioLegend Cat. No. 363525)
Antigen Details
- Structure
- Ig superfamily, a type I glycosylated integral transmembrane protein, 120-130 kD
- Distribution
-
B cells
- Function
- Adhesion, B-monocyte and B-T interactions
- Ligand/Receptor
- CD45RO, CD75
- Cell Type
- B cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules, Siglec Molecules
- Antigen References
-
- Clark E. 1993. J. Immunol. 150:4715.
- Shan D, et al. 1995. J. Immunol. 154:4466.
- Gene ID
- 933 View all products for this Gene ID
- UniProt
- View information about CD22 on UniProt.org
Other Formats
View All CD22 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD22 | S-HCL-1 | FC |
Brilliant Violet 421™ anti-human CD22 | S-HCL-1 | FC |
PE anti-human CD22 | S-HCL-1 | FC |
APC anti-human CD22 | S-HCL-1 | FC |
FITC anti-human CD22 | S-HCL-1 | FC |
TotalSeq™-A0393 anti-human CD22 | S-HCL-1 | PG |
TotalSeq™-C0393 anti-human CD22 | S-HCL-1 | PG |
PE/Cyanine7 anti-human CD22 | S-HCL-1 | FC |
PerCP/Cyanine5.5 anti-human CD22 | S-HCL-1 | FC |
TotalSeq™-B0393 anti-human CD22 | S-HCL-1 | PG |
APC/Fire™ 750 anti-human CD22 | S-HCL-1 | FC |
TotalSeq™-D0393 anti-human CD22 | S-HCL-1 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD22
-
Brilliant Violet 421™ anti-human CD22
-
PE anti-human CD22
-
APC anti-human CD22
-
FITC anti-human CD22
-
TotalSeq™-A0393 anti-human CD22
-
TotalSeq™-C0393 anti-human CD22
-
PE/Cyanine7 anti-human CD22
-
PerCP/Cyanine5.5 anti-human CD22
-
TotalSeq™-B0393 anti-human CD22
-
APC/Fire™ 750 anti-human CD22
-
TotalSeq™-D0393 anti-human CD22
Follow Us