- Clone
- HI149 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V CD01.01
- Other Names
- T6, R4
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GATCGTGTTGTGTTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
300145 | 10 µg | 296€ |
CD1a is a 49 kD member of the immunoglobulin superfamily also known as T6 and R4. It is a type I membrane glycoprotein with structural similarities to MHC class I and is non-covalently associated with β2-microglobulin. CD1a plays a role in non-peptide glycolipid antigen presentation to CD1-restricted T cells. It is expressed on cortical double positive and single positive thymocytes, Langerhans cells, and dendritic cells. In addition to antigen presentation, CD1a has been implicated in thymic T cell development.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) - RRID
-
AB_2892341 (BioLegend Cat. No. 300145)
Antigen Details
- Structure
- Ig superfamily, MHC I-like molecule, type I transmembrane glycoprotein, 49 kD
- Distribution
-
Cortical thymocytes, Langerhans cells, dendritic cells
- Function
- Antigen presentation, lymphocyte activation, thymic T cell development
- Ligand/Receptor
- CD1-restricted TCRs
- Cell Type
- Dendritic cells, Langerhans cells, Thymocytes
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- CD Molecules
- Antigen References
-
- Blumberg RS, et al. 1995. Immunol. Rev. 147:5.
- Calabi F, et al. 1991. Tissue Antigens 37:1.
- Melian A, et al. 1996. Curr. Opin. Immunol. 8:82.
- Gene ID
- 909 View all products for this Gene ID
- UniProt
- View information about CD1a on UniProt.org
Other Formats
View All CD1a Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
FITC anti-human CD1a | HI149 | FC |
PE anti-human CD1a | HI149 | FC |
PE/Cyanine5 anti-human CD1a | HI149 | FC |
APC anti-human CD1a | HI149 | FC |
Purified anti-human CD1a | HI149 | FC,IHC-F |
Biotin anti-human CD1a | HI149 | FC |
Alexa Fluor® 488 anti-human CD1a | HI149 | FC |
Alexa Fluor® 647 anti-human CD1a | HI149 | FC |
Pacific Blue™ anti-human CD1a | HI149 | FC |
Alexa Fluor® 700 anti-human CD1a | HI149 | FC |
Brilliant Violet 421™ anti-human CD1a | HI149 | FC |
PE/Cyanine7 anti-human CD1a | HI149 | FC |
APC/Cyanine7 anti-human CD1a | HI149 | FC |
PerCP/Cyanine5.5 anti-human CD1a | HI149 | FC |
PE/Dazzle™ 594 anti-human CD1a | HI149 | FC |
TotalSeq™-A0402 anti-human CD1a | HI149 | PG |
TotalSeq™-C0402 anti-human CD1a | HI149 | PG |
Brilliant Violet 711™ anti-human CD1a | HI149 | FC |
APC/Fire™ 750 anti-human CD1a | HI149 | FC |
Brilliant Violet 605™ anti-human CD1a | HI149 | FC |
TotalSeq™-B0402 anti-human CD1a | HI149 | PG |
TotalSeq™-D0402 anti-human CD1a | HI149 | PG |
Brilliant Violet 510™ anti-human CD1a | HI149 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
FITC anti-human CD1a
-
PE anti-human CD1a
-
PE/Cyanine5 anti-human CD1a
-
APC anti-human CD1a
-
Purified anti-human CD1a
-
Biotin anti-human CD1a
-
Alexa Fluor® 488 anti-human CD1a
-
Alexa Fluor® 647 anti-human CD1a
-
Pacific Blue™ anti-human CD1a
-
Alexa Fluor® 700 anti-human CD1a
-
Brilliant Violet 421™ anti-human CD1a
-
PE/Cyanine7 anti-human CD1a
-
APC/Cyanine7 anti-human CD1a
-
PerCP/Cyanine5.5 anti-human CD1a
-
PE/Dazzle™ 594 anti-human CD1a
-
TotalSeq™-A0402 anti-human CD1a
-
TotalSeq™-C0402 anti-human CD1a
-
Brilliant Violet 711™ anti-human CD1a
-
APC/Fire™ 750 anti-human CD1a
-
Brilliant Violet 605™ anti-human CD1a
-
TotalSeq™-B0402 anti-human CD1a
-
TotalSeq™-D0402 anti-human CD1a
-
Brilliant Violet 510™ anti-human CD1a
Follow Us