TotalSeq™-D0865 anti-human VEGFR-3 (FLT-4) Antibody

Pricing & Availability
Clone
9D9F9 (See other available formats)
Regulatory Status
RUO
Other Names
Receptor tyrosine Kinase VEGFR-3, VEGFR3, FLT4
Isotype
Mouse IgG1, κ
Barcode Sequence
TGATCCGAAGTCGTG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
356211 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Receptor tyrosine Kinase VEGFR-3, also known as FLT4, together with VEGFR1 (FIT1) and VEGFR2 (KDR/Flk-1), are the receptors for vascular endothelial growth factors (VEGF). The VEGFR family belongs to the class II subfamily of receptor tyrosine kinases (RTKs), containing a large extracellular region which is composed of seven Ig-like domains (D1–D7), a single transmembrane, helix, and a cytoplasmic region with tyrosine kinase activity. In VEGFR-3, the fifth Ig homology domain is proteolytically cleaved which results in polypeptides that remain linked by two disulfide bonds. VEGFR-3 is widely expressed on all endothelial cells in early embryogenesis, while, in adult tissues, VEGFR-3 expression disappears from the vascular endothelial cells and is observed only on the lymphatic endothelium. VEGF-C and VEGF-D activation of VEGFR-3 plays an important role in the formation of the lymphatic vessel system. Aberrant activation or expression of VEGFR and their ligands has been implicated in tumor angiogenesis, coronary artery disease, diabetic blindness, and other diseases.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
VEGFR extracellular domain protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for relevant formats) include: immunohistochemistry staining of frozen or paraffin embedded sections1-3.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Jussila L, et al. 1998. Cancer Res. 58:1599. (IHC)
  2. Kilic N, et al. 2007. Blood 110:4223. (IHC)
  3. Folpe A, et al. 2000. Mod. Pathol. 13:180. (IHC)

Antigen Details

Structure
Seven Ig-like domains in the extracellular domain, a single transmembrane helix, and a cytoplasmic region with tyrosine kinase activity
Distribution

Widely expressed in early embryogenesis endothelial cells, restrictly expressed on lymphatic endothelial cells in adults

Function
Mediates lymphangiogenesis in response to VEGF-C and VEGF-D, involved in cardiovascular development during embryogenesis
Ligand/Receptor
VEGF-C, VEGF-D
Biology Area
Cell Biology, Immunology, Signal Transduction
Molecular Family
Cytokine/Chemokine Receptors
Antigen References

1. Tammela T, et al. 2008. Nature 454:656.
2. Partanen TA, et al. 2000. FASEB J. 14:2087.
3. Valtola R, et al. 1999. Am. J. Pathol. 154:1381.
4. Jussila L, et al. 1998. Cancer Res. 58:1599.
5. Galland F, et al. 1992. Genomics 13:475.

Gene ID
2324 View all products for this Gene ID
UniProt
View information about VEGFR-3 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 09.26.2024

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account