IMPORTANT NOTICE: Our email addresses will soon change. Learn more >>

TotalSeq™-D0902 anti-human CD328 (Siglec-7) Antibody

Pricing & Availability
Clone
6-434 (See other available formats)
Regulatory Status
RUO
Workshop
VIII 80652
Other Names
Siglec7 (Sialic-binding Ig like lectin 7), p75, AIRM1
Isotype
Mouse IgG1, κ
Barcode Sequence
CTTAGCATTTCACTG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
339221 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Siglec-7, also known as p75/AIRM1, is a 75 kD type I transmembrane protein and a member of the family of sialic acid-binding immunoglobulin-like lectins (Siglecs). It is primarily found on NK cells and monocytes. The cytoplasmic domain of Siglec-7 contains immunoreceptor tyrosine-based inhibitory motif (ITIM). CD328 mediates sialic acid-dependent cell-cell binding and functions as an inhibitory receptor of NK cells. CD328 preferentially binds to sialylated glycans with α2,8 disialyl and α2,6 sialyl residues.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Antigen Details

Structure
Type I transmembrane protein, Siglec family member, 75 kD
Distribution

NK cells, monocytes

Function
Inhibitory receptor of NK cells
Ligand/Receptor
Sialylated glycans (with α2,8 disialyl and α2,6 sialyl residues)
Cell Type
Monocytes, NK cells
Biology Area
Immunology
Molecular Family
CD Molecules, Siglec Molecules
Antigen References
  1. Avril T, et al. 2006. Infection and Immunity 74:4133
  2. Avril T, et al. 2004. J. Immunol. 173:6841
  3. Yamaji T, et al. 2005. Glycobiology 15:667
Gene ID
27036 View all products for this Gene ID
UniProt
View information about CD328 on UniProt.org
Go To Top Version: 1    Revision Date: 01.31.2025

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account