- Clone
- 5C3 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V CD40.4
- Other Names
- BP50, TNFRSF5
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CTCAGATGGAGTATG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
334354 | 10 µg | 287€ |
CD40 is a 48 kD type I glycoprotein also known as BP50. It is a member of the TNFR superfamily primarily expressed on B cells, macrophages, follicular dendritic cells, endothelial cells, fibroblasts, and at low levels on plasma cells. CD40 has been reported to be involved in B cell differentiation, costimulation, isotype class-switching, and protection of B cells from apoptosis. Additionally, CD40 is important for T cell-B cell interactions. The ligand of CD40 is CD154 (CD40 ligand). The 5C3 antibody has been reported to promote B cell proliferation in the presence of anti-IgM, IL-4 or PMA, partially blocking CD40 binding to CD40L, and B cells rescue from apoptosis.
Product DetailsProduct Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Reported Reactivity
- Baboon, Chimpanzee, Squirrel Monkey
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: costimulation of B cell proliferation1, partial inhibition of CD40 binding to CD40L3, and B cell rescue from apoptosis1. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Schlossman SF, et al. 1995. ed. Leukocyte Typing V:White Cell Differentiation Antigens. New York:Oxford University Press.
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Pound JD, et al. 1999. Int. Immunol. 11:11.
- Shey MS, et al. 2014. J Immunol. 192:4833. PubMed
- Sondergaard JN, et al. 2014. Mol Immunol. 59:180. PubMed
- Saiki O, et al. 1995. J Clin. Invest. 2: 510-4 (Costim)
- RRID
-
AB_2924539 (BioLegend Cat. No. 334354)
Antigen Details
- Structure
- TNFR superfamily, type I glycoprotein, 48 kD
- Distribution
-
B cells, macrophages, follicular dendritic cells, endothelial cells, fibroblasts
- Function
- B cell differentiation, costimulation, isotype class-switching, rescues B cells from apoptosis
- Ligand/Receptor
- CD154 (CD40 ligand)
- Cell Type
- B cells, Dendritic cells, Endothelial cells, Fibroblasts, Macrophages
- Biology Area
- Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers
- Molecular Family
- CD Molecules
- Antigen References
-
1. Banchereau J, et al. 1994. Annu. Rev. Immunol. 12:881.
2. Foy T, et al. 1996. Annu. Rev. Immunol. 14:591. - Gene ID
- 958 View all products for this Gene ID
- UniProt
- View information about CD40 on UniProt.org
Related FAQs
Other Formats
View All CD40 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Alexa Fluor® 488 anti-human CD40
-
Purified anti-human CD40
-
FITC anti-human CD40
-
PE anti-human CD40
-
APC anti-human CD40
-
Alexa Fluor® 647 anti-human CD40
-
PerCP/Cyanine5.5 anti-human CD40
-
Pacific Blue™ anti-human CD40
-
PE/Cyanine7 anti-human CD40
-
APC/Cyanine7 anti-human CD40
-
Alexa Fluor® 700 anti-human CD40
-
Purified anti-human CD40 (Maxpar® Ready)
-
Brilliant Violet 510™ anti-human CD40
-
Brilliant Violet 421™ anti-human CD40
-
Brilliant Violet 711™ anti-human CD40
-
Brilliant Violet 605™ anti-human CD40
-
Brilliant Violet 650™ anti-human CD40
-
Brilliant Violet 785™ anti-human CD40
-
PE/Dazzle™ 594 anti-human CD40
-
Biotin anti-human CD40
-
APC/Fire™ 750 anti-human CD40
-
TotalSeq™-A0031 anti-human CD40
-
TotalSeq™-C0031 anti-human CD40
-
Ultra-LEAF™ Purified anti-human CD40
-
TotalSeq™-B0031 anti-human CD40
-
TotalSeq™-D0031 anti-human CD40
-
PE/Fire™ 810 anti-human CD40
Follow Us