TotalSeq™-D0091 Mouse IgG2a, κ Isotype Ctrl Antibody

Pricing & Availability
Clone
MOPC-173 (See other available formats)
Regulatory Status
RUO
Isotype
Mouse IgG2a, κ
Barcode Sequence
CTCCTACCTAAACTG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
400299 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

The MOPC-173 immunoglobulin has unknown specificity. The isotype of this antibody is mouse IgG2a, κ. This antibody was chosen as an isotype control after screening on a variety of resting, activated, live, and fixed mouse, rat, and human tissues.

Product Details
Technical data sheet

Product Details

Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: Intracellular Flow Cytometry (ICFC), Immunocytochemistry (ICC), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western Blotting (WB), Functional Assay (FA).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Product Citations
  1. Sun W, et al. 2023. Nature. 614:309. PubMed
RRID
AB_3097117 (BioLegend Cat. No. 400299)

Antigen Details

Gene ID
NA

Related FAQs

IgG2a gene is deleted in some mouse strains, which ones are they?

IgG2a gene is deleted in C57Bl/6, C57Bl/10, SJL, and NOD mice. It is replaced with IgG2c gene instead.

Other Formats

View All Reagents Request Custom Conjugation
Description Clone Applications
APC Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Biotin Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
FITC Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
PE Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
PE/Cyanine5 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Purified Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC,ICC,IHC,IP,WB,FA,ChIP
APC/Cyanine7 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
PE/Cyanine7 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Alexa Fluor® 647 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Alexa Fluor® 488 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Pacific Blue™ Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
PE Mouse IgG2a, κ Isotype Ctrl (ICFC) MOPC-173 ICFC
FITC Mouse IgG2a, κ Isotype Ctrl (FC) MOPC-173 FC
PE Mouse IgG2a, κ Isotype Ctrl (FC) MOPC-173 FC
APC Mouse IgG2a, κ Isotype Ctrl (FC) MOPC-173 FC
Brilliant Violet 605™ Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Alexa Fluor® 700 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
PerCP Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
PerCP/Cyanine5.5 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Brilliant Violet 421™ Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Brilliant Violet 570™ Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Ultra-LEAF™ Purified Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC,ICC,IHC,IP,WB,FA
Brilliant Violet 510™ Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Brilliant Violet 650™ Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Brilliant Violet 711™ Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Brilliant Violet 785™ Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
PE/Dazzle™ 594 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Alexa Fluor® 594 Mouse IgG2a, κ Isotype Ctrl MOPC-173 ICC
FITC Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
APC/Fire™ 750 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Pacific Blue™ Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
APC Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
PE/Dazzle™ 594 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
PE Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
TotalSeq™-A0091 Mouse IgG2a, κ isotype Ctrl MOPC-173 PG
TotalSeq™-B0091 Mouse IgG2a, κ isotype Ctrl MOPC-173 PG
TotalSeq™-C0091 Mouse IgG2a, κ isotype Ctrl MOPC-173 PG
PE/Cyanine7 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
APC/Fire™ 750 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
PerCP/Cyanine5.5 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
KIRAVIA Blue 520™ Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
Spark Blue™ 550 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Spark NIR™ 685 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Spark Violet™ 538 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Spark YG™ 581 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
TotalSeq™-D0091 Mouse IgG2a, κ Isotype Ctrl MOPC-173 PG
Spark YG™ 593 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
GMP PE Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
GMP FITC Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
GMP APC Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
GMP PE/Dazzle™ 594 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
GMP APC/Fire™ 750 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
GMP PerCP/Cyanine5.5 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
PE/Fire™ 700 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
PE/Fire™ 810 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
PE/Fire™ 640 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
GMP PE/Cyanine7 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
GMP Pacific Blue™ Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
Spark YG™ 570 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
Spark Violet™ 423 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
APC/Fire™ 810 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
PerCP/Fire™ 806 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
PerCP/Fire™ 780 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
Spark Red™ 718 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Spark Blue™ 515 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Spark Blue™ 574 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
PE/Fire™ 744 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC,ICFC
Alexa Fluor® 660 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
Spark UV™ 387 Mouse IgG2a, κ Isotype Ctrl MOPC-173 FC
Go To Top Version: 1    Revision Date: 05.17.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC Mouse IgG2a, κ Isotype Ctrl

  • Biotin Mouse IgG2a, κ Isotype Ctrl

  • FITC Mouse IgG2a, κ Isotype Ctrl

  • PE Mouse IgG2a, κ Isotype Ctrl

  • PE/Cyanine5 Mouse IgG2a, κ Isotype Ctrl

  • Purified Mouse IgG2a, κ Isotype Ctrl

    MOPC-173_GoChIP_IgG2a_Antibody_060618_updated.png
    Chromatin Immunoprecipitations (ChIP) were performed with cr...
  • APC/Cyanine7 Mouse IgG2a, κ Isotype Ctrl

  • PE/Cyanine7 Mouse IgG2a, κ Isotype Ctrl

  • Alexa Fluor® 647 Mouse IgG2a, κ Isotype Ctrl

  • Alexa Fluor® 488 Mouse IgG2a, κ Isotype Ctrl

  • Pacific Blue™ Mouse IgG2a, κ Isotype Ctrl

  • PE Mouse IgG2a, κ Isotype Ctrl (ICFC)

  • FITC Mouse IgG2a, κ Isotype Ctrl (FC)

  • PE Mouse IgG2a, κ Isotype Ctrl (FC)

  • APC Mouse IgG2a, κ Isotype Ctrl (FC)

  • Brilliant Violet 605™ Mouse IgG2a, κ Isotype Ctrl

  • Alexa Fluor® 700 Mouse IgG2a, κ Isotype Ctrl

  • PerCP Mouse IgG2a, κ Isotype Ctrl

  • PerCP/Cyanine5.5 Mouse IgG2a, κ Isotype Ctrl

  • Brilliant Violet 421™ Mouse IgG2a, κ Isotype Ctrl

  • Brilliant Violet 570™ Mouse IgG2a, κ Isotype Ctrl

  • Ultra-LEAF™ Purified Mouse IgG2a, κ Isotype Ctrl

  • Brilliant Violet 510™ Mouse IgG2a, κ Isotype Ctrl

  • Brilliant Violet 650™ Mouse IgG2a, κ Isotype Ctrl

  • Brilliant Violet 711™ Mouse IgG2a, κ Isotype Ctrl

  • Brilliant Violet 785™ Mouse IgG2a, κ Isotype Ctrl

  • PE/Dazzle™ 594 Mouse IgG2a, κ Isotype Ctrl

  • Alexa Fluor® 594 Mouse IgG2a, κ Isotype Ctrl

  • FITC Mouse IgG2a, κ Isotype Ctrl

  • APC/Fire™ 750 Mouse IgG2a, κ Isotype Ctrl

  • Pacific Blue™ Mouse IgG2a, κ Isotype Ctrl

  • APC Mouse IgG2a, κ Isotype Ctrl

  • PE/Dazzle™ 594 Mouse IgG2a, κ Isotype Ctrl

  • PE Mouse IgG2a, κ Isotype Ctrl

  • TotalSeq™-A0091 Mouse IgG2a, κ isotype Ctrl

  • TotalSeq™-B0091 Mouse IgG2a, κ isotype Ctrl

  • TotalSeq™-C0091 Mouse IgG2a, κ isotype Ctrl

  • PE/Cyanine7 Mouse IgG2a, κ Isotype Ctrl

  • APC/Fire™ 750 Mouse IgG2a, κ Isotype Ctrl

  • PerCP/Cyanine5.5 Mouse IgG2a, κ Isotype Ctrl

  • KIRAVIA Blue 520™ Mouse IgG2a, κ Isotype Ctrl

  • Spark Blue™ 550 Mouse IgG2a, κ Isotype Ctrl

  • Spark NIR™ 685 Mouse IgG2a, κ Isotype Ctrl

  • Spark Violet™ 538 Mouse IgG2a, κ Isotype Ctrl

  • Spark YG™ 581 Mouse IgG2a, κ Isotype Ctrl

  • TotalSeq™-D0091 Mouse IgG2a, κ Isotype Ctrl

  • Spark YG™ 593 Mouse IgG2a, κ Isotype Ctrl

  • GMP PE Mouse IgG2a, κ Isotype Ctrl

  • GMP FITC Mouse IgG2a, κ Isotype Ctrl

  • GMP APC Mouse IgG2a, κ Isotype Ctrl

  • GMP PE/Dazzle™ 594 Mouse IgG2a, κ Isotype Ctrl

  • GMP APC/Fire™ 750 Mouse IgG2a, κ Isotype Ctrl

  • GMP PerCP/Cyanine5.5 Mouse IgG2a, κ Isotype Ctrl

  • PE/Fire™ 700 Mouse IgG2a, κ Isotype Ctrl

  • PE/Fire™ 810 Mouse IgG2a, κ Isotype Ctrl

  • PE/Fire™ 640 Mouse IgG2a, κ Isotype Ctrl

  • GMP PE/Cyanine7 Mouse IgG2a, κ Isotype Ctrl

  • GMP Pacific Blue™ Mouse IgG2a, κ Isotype Ctrl

  • Spark YG™ 570 Mouse IgG2a, κ Isotype Ctrl

  • Spark Violet™ 423 Mouse IgG2a, κ Isotype Ctrl

  • APC/Fire™ 810 Mouse IgG2a, κ Isotype Ctrl

  • PerCP/Fire™ 806 Mouse IgG2a, κ Isotype Ctrl

  • PerCP/Fire™ 780 Mouse IgG2a, κ Isotype Ctrl

  • Spark Red™ 718 Mouse IgG2a, κ Isotype Ctrl

  • Spark Blue™ 515 Mouse IgG2a, κ Isotype Ctrl

  • Spark Blue™ 574 Mouse IgG2a, κ Isotype Ctrl

  • PE/Fire™ 744 Mouse IgG2a, κ Isotype Ctrl

  • Alexa Fluor® 660 Mouse IgG2a, κ Isotype Ctrl

  • Spark UV™ 387 Mouse IgG2a, κ Isotype Ctrl

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account