- Clone
- UCHT2 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- III 518
- Other Names
- Leu-1, Ly-1, T1, Tp67
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CATTAACGGGATGCC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
300647 | 10 µg | 296€ |
CD5 is a 67 kD single chain type I glycoprotein also known as Leu-1, Ly-1 and T1. It is a member of the scavenger receptor superfamily found on T cells, thymocytes, B cell subsets, chronic B lymphocytic leukemia (B-CLL), and peripheral blood dendritic cells. CD5 modulates T and B cell receptor signaling, thymocyte maturation, and T-B cell interactions upon binding to ligands such as CD72.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Chimpanzee, Capuchin Monkey, Common Marmoset, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: Western blotting2 and immunohistochemical staining of acetone-fixed frozen sections2,5.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Knapp W, et al. 1989. Leucocyte Typing IV Oxford University Press. New York.
- Renaudineau Y, et al. 2005. Blood 106:2781. (WB IHC)
- Porter JC and Hogg N. 1997. J. Cell Biol. 138:1437.
- Saliba AE, et al. 2010. P. Natl. Acad. Sci. USA 107:14524. PubMed
- Kap Y, et al. 2009. J. Histochem. Cytochem. 57:1159. (IHC)
- RRID
-
AB_2892344 (BioLegend Cat. No. 300647)
Antigen Details
- Structure
- Scavenger receptor superfamily, 67 kD
- Distribution
-
T cells, thymocytes, B cell subset, B cell CLL, peripheral blood dendritic cells
- Function
- Modulates TCR, BCR signaling, thymocyte maturation, T-B cell interaction
- Ligand/Receptor
- CD72
- Cell Type
- B cells, Dendritic cells, Leukemia, T cells, Thymocytes
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Kipps T. 1988. Adv. Immunol. 47:117.
2. Resnick D, et al. 1993. Trends Biochem. Sci. 19:5.
3. Wood GS, et al. 1992. Am. J. Pathol. 14:789. - Gene ID
- 921 View all products for this Gene ID
- UniProt
- View information about CD5 on UniProt.org
Other Formats
View All CD5 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
APC anti-human CD5 | UCHT2 | FC |
Biotin anti-human CD5 | UCHT2 | FC |
FITC anti-human CD5 | UCHT2 | FC |
PE anti-human CD5 | UCHT2 | FC |
Purified anti-human CD5 | UCHT2 | FC,IHC-F,WB |
Alexa Fluor® 647 anti-human CD5 | UCHT2 | FC |
PerCP anti-human CD5 | UCHT2 | FC |
PerCP/Cyanine5.5 anti-human CD5 | UCHT2 | FC |
PE/Cyanine7 anti-human CD5 | UCHT2 | FC |
Pacific Blue™ anti-human CD5 | UCHT2 | FC |
Brilliant Violet 421™ anti-human CD5 | UCHT2 | FC |
Purified anti-human CD5 (Maxpar® Ready) | UCHT2 | FC,CyTOF® |
APC/Cyanine7 anti-human CD5 | UCHT2 | FC |
Alexa Fluor® 700 anti-human CD5 | UCHT2 | FC |
PE/Dazzle™ 594 anti-human CD5 | UCHT2 | FC |
TotalSeq™-A0138 anti-human CD5 | UCHT2 | PG |
TotalSeq™-C0138 anti-human CD5 | UCHT2 | PG |
APC/Fire™ 750 anti-human CD5 | UCHT2 | FC |
Brilliant Violet 711™ anti-human CD5 | UCHT2 | FC |
TotalSeq™-B0138 anti-human CD5 Antibody | UCHT2 | PG |
TotalSeq™-D0138 anti-human CD5 | UCHT2 | PG |
Brilliant Violet 510™ anti-human CD5 | UCHT2 | FC |
Spark Red™ 718 anti-human CD5 (Flexi-Fluor™) | UCHT2 | FC |
Brilliant Violet 605™ anti-human CD5 | UCHT2 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD5
-
Biotin anti-human CD5
-
FITC anti-human CD5
-
PE anti-human CD5
-
Purified anti-human CD5
-
Alexa Fluor® 647 anti-human CD5
-
PerCP anti-human CD5
-
PerCP/Cyanine5.5 anti-human CD5
-
PE/Cyanine7 anti-human CD5
-
Pacific Blue™ anti-human CD5
-
Brilliant Violet 421™ anti-human CD5
-
Purified anti-human CD5 (Maxpar® Ready)
-
APC/Cyanine7 anti-human CD5
-
Alexa Fluor® 700 anti-human CD5
-
PE/Dazzle™ 594 anti-human CD5
-
TotalSeq™-A0138 anti-human CD5
-
TotalSeq™-C0138 anti-human CD5
-
APC/Fire™ 750 anti-human CD5
-
Brilliant Violet 711™ anti-human CD5
-
TotalSeq™-B0138 anti-human CD5 Antibody
-
TotalSeq™-D0138 anti-human CD5
-
Brilliant Violet 510™ anti-human CD5
-
Spark Red™ 718 anti-human CD5 (Flexi-Fluor™)
-
Brilliant Violet 605™ anti-human CD5
Follow Us