TotalSeq™-D0147 anti-human CD62L Antibody

Pricing & Availability
Clone
DREG-56 (See other available formats)
Regulatory Status
RUO
Workshop
V S056
Other Names
L-selectin, LECAM-1, LAM-1, Leu-8, TQ-1
Isotype
Mouse IgG1, κ
Barcode Sequence
GTCCCTGCAACTTGA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
304863 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD62L is a 74-95 kD single chain type I glycoprotein referred to as L-selectin or LECAM-1. It is expressed on most peripheral blood B cells, subsets of T and NK cells, monocytes, granulocytes, and certain hematopoietic malignant cells. CD62L binds to carbohydrates present on certain glycoforms of CD34, glycam-1, and MAdCAM-1 and with a low affinity to anionic oligosaccharide sequences related to sialylated Lewis X (sLex, CD15s) through its C-type lectin domain. CD62L is important for the homing of naïve lymphocytes to high endothelial venules in peripheral lymph nodes and Peyer's patches. It also plays a role in leukocyte rolling on activated endothelial cells.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
Chimpanzee, Cow
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Concentrated supernatant from PMA-activated human peripheral blood leukocytes
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: Western blotting2,3,9 and in vitro blocking of lymphocytes binding to high endothelial venules (HEV)2. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 304853-304858).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
  2. Kishimoto TK, et al. 1990. Proc. Natl. Acad. Sci. USA 87:2244. (WB, Block)
  3. Jutila M, et al. 2002. J. Immunol. 169:1768. (WB)
  4. Tamassia N, et al. 2008. J. Immunol. 181:6563. (FC) PubMed
  5. Kmieciak M, et al. 2009. J. Transl. Med. 7:89. (FC) PubMed
  6. Thakral D, et al. 2008. J. Immunol. 180:7431. (FC) PubMed
  7. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
  8. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  9. Koenig JM, et al. 1996. Pediatr. Res. 39:616. (WB)
  10. Shi C, et al. 2011. J. Immunol. 187:5293. (FC) PubMed
  11. Burges M, et al. 2013. Clin Cancer Res. 19:5675. PubMed
  12. Cash JL, et al. 2013. EMBO Rep. 14:999. (FC) PubMed
RRID
AB_2894612 (BioLegend Cat. No. 304863)

Antigen Details

Structure
Selectin, single chain glycoprotein, 74-95 kD
Distribution

Majority of B cells, naïve T cells, subset of memory T and NK cells, monocytes, granulocytes, thymocytes

Function
Leukocyte homing, leukocyte tethering, rolling
Ligand/Receptor
CD34, GlyCAM, MAdCAM-1
Cell Type
B cells, Granulocytes, Monocytes, Neutrophils, NK cells, T cells, Thymocytes, Tregs
Biology Area
Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology, Innate Immunity
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References
  1. Kishimoto T, et al. 1990. P. Natl. Acad. Sci. USA 87:2244.
  2. Kishimoto T, et al. 1991. Blood 78:805.

 

Gene ID
6402 View all products for this Gene ID
UniProt
View information about CD62L on UniProt.org

Other Formats

View All CD62L Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD62L DREG-56 FC
FITC anti-human CD62L DREG-56 FC
PE anti-human CD62L DREG-56 FC
PE/Cyanine5 anti-human CD62L DREG-56 FC
Purified anti-human CD62L DREG-56 FC,WB,Block
APC/Cyanine7 anti-human CD62L DREG-56 FC
Alexa Fluor® 488 anti-human CD62L DREG-56 FC
Alexa Fluor® 647 anti-human CD62L DREG-56 FC
Alexa Fluor® 700 anti-human CD62L DREG-56 FC
PE/Cyanine7 anti-human CD62L DREG-56 FC
PerCP/Cyanine5.5 anti-human CD62L DREG-56 FC
Pacific Blue™ anti-human CD62L DREG-56 FC
Brilliant Violet 421™ anti-human CD62L DREG-56 FC
Brilliant Violet 785™ anti-human CD62L DREG-56 FC
Brilliant Violet 650™ anti-human CD62L DREG-56 FC
PE/Dazzle™ 594 anti-human CD62L DREG-56 FC
Brilliant Violet 605™ anti-human CD62L DREG-56 FC
Purified anti-human CD62L (Maxpar® Ready) DREG-56 FC,CyTOF®
APC/Fire™ 750 anti-human CD62L DREG-56 FC
Brilliant Violet 510™ anti-human CD62L DREG-56 FC
TotalSeq™-A0147 anti-human CD62L DREG-56 PG
TotalSeq™-B0147 anti-human CD62L DREG-56 PG
TotalSeq™-C0147 anti-human CD62L DREG-56 PG
Ultra-LEAF™ Purified anti-human CD62L DREG-56 FC,Block,WB
Brilliant Violet 711™ anti-human CD62L DREG-56 FC
Spark NIR™ 685 anti-human CD62L DREG-56 FC
TotalSeq™-D0147 anti-human CD62L DREG-56 PG
APC/Fire™ 810 anti-human CD62L DREG-56 FC
FITC anti-human CD62L DREG-56 FC
PE/Dazzle™ 594 anti-human CD62L DREG-56 FC
PerCP/Fire™ 806 anti-human CD62L DREG-56 FC
APC anti-human CD62L DREG-56 FC
GMP FITC anti-human CD62L DREG-56 FC
Go To Top Version: 1    Revision Date: 08.16.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account