TotalSeq™-D0181 anti-human CD21 Antibody

Pricing & Availability
Clone
Bu32 (See other available formats)
Regulatory Status
RUO
Workshop
V CD21.4, VI CD21.5
Other Names
Complement C3d receptor (C3dR), complement receptor 2 (CR2), Epstein-Barr virus receptor
Isotype
Mouse IgG1, κ
Barcode Sequence
AACCTAGTAGTTCGG
Ave. Rating
Submit a Review
Cat # Size Price Quantity Check Availability Save
354931 10 µg 287€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD21 is a 145 kD transmembrane protein also known as complement C3d receptor (C3dR), complement receptor 2 (CR2), and Epstein-Barr virus receptor. CD21 is expressed on B cells, follicular dendritic cells, subsets of normal thymocytes and T cells, and some epithelial cells. CD21 is the receptor used by Epstein-Barr virus to infect B cells and is also the complement receptor for C3d. CD21 has also been shown to interact with a number of proteins, including CD23, CD19, annexin VI, CD81, iC3b, complement receptor 1 (CR1, CD35), and interferon-alpha 1 (IFN-α1).

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections4.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Björck P, et al. 1993. Eur. J. Immunol. 23:1771.
  2. Frémeaux-Bacchi V, et al. 1996. Eur. J. Immunol. 26:1497.
  3. Ling NR, et al. 1995. Clin. Exp. Immunol. 101:369.
  4. Wang, C, et al. 2011. BMC Immunol. 12:53. (IHC)
RRID
AB_2924554 (BioLegend Cat. No. 354931)

Antigen Details

Structure
Transmembrane protein, multiple SUSHI domains, approximate molecular weight 145 kD
Distribution

Expressed on B cells, follicular dendritic cells, subsets of normal thymocytes and T cells, some epithelial cells

Function
Epstein-Barr virus receptor on B cells used for infection
Interaction
CD23, CD19, complement component 3, annexin VI, CD81, iC3b, complement receptor 1, interferon alpha 1
Ligand/Receptor
C3d, EBV
Cell Type
B cells, Dendritic cells, Epithelial cells, T cells, Thymocytes
Biology Area
Cell Biology, Complement, Costimulatory Molecules, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
Molecular Family
CD Molecules
Antigen References

1. Kishimoto T, Eds. 1997. Leukocyte Typing VI. Garland Publishing Inc.
2. Moore MD, et al. 1987. Proc. Natl. Acad. Sci. USA 84:9194.
3. Szakonyi G, et al. 2001. Science 292:1725.
4. Weis JJ, et al. 1984. Proc. Natl. Acad. Sci. USA 81:881.

Gene ID
1380 View all products for this Gene ID
UniProt
View information about CD21 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 09.02.2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account