- Clone
- HIR2 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- VII 70299
- Other Names
- Glycophorin A/B, GPA/GPB, GYPA, GYPB
- Isotype
- Mouse IgG2b, κ
- Barcode Sequence
- GCTCCTTTACACGTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
306629 | 10 µg | 296€ |
The HIR2 antibody reacts with a common epitope of glycophorin A (CD235a) and glycophorin B (CD235b). Glycophorin A is the major sialoglycoprotein expressed on red blood cell membrane, and erythroid precursors. Glycophorin A shares strong homology with glycophorin B. The HIR2 antibody recognizes human RBCs and erythroid precursors and is useful in erythroid cell development studies. Mature, non-nucleated red blood cells are characteristically glycophorin A positive, but CD45 and CD71 negative.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Mason D, et al. Eds. 2002. Leucocyte Typing VII. Oxford University Press. New York.
- RRID
-
AB_2924526 (BioLegend Cat. No. 306629)
Antigen Details
- Structure
- Sialoglycoprotein, 20 kD
- Distribution
-
Erythrocytes
- Cell Type
- Erythrocytes
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Mason D, et al. Eds. 2002. Leucocyte Typing VII. Oxford University Press. New York.
- Gene ID
- 2993 View all products for this Gene ID
- UniProt
- View information about CD235ab on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD235ab Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
APC anti-human CD235ab | HIR2 | FC |
PE anti-human CD235ab | HIR2 | FC |
PE/Cyanine5 anti-human CD235ab | HIR2 | FC |
Purified anti-human CD235ab | HIR2 | FC,CyTOF®,IHC-P,SB |
FITC anti-human CD235ab | HIR2 | FC |
Pacific Blue™ anti-human CD235ab | HIR2 | FC |
PerCP/Cyanine5.5 anti-human CD235ab | HIR2 | FC |
Purified anti-human CD235ab (Maxpar® Ready) | HIR2 | FC,CyTOF® |
Biotin anti-human CD235ab | HIR2 | FC |
PE/Cyanine7 anti-human CD235ab | HIR2 | FC |
APC/Fire™ 750 anti-human CD235ab | HIR2 | FC |
TotalSeq™-A0196 anti-human CD235ab | HIR2 | PG |
TotalSeq™-C0196 anti-human CD235ab | HIR2 | PG |
TotalSeq™-B0196 anti-human CD235ab | HIR2 | PG |
TotalSeq™-D0196 anti-human CD235ab | HIR2 | PG |
TotalSeq™-Bn0196 anti-human CD235ab | HIR2 | SB |
Spark PLUS UV395™ anti-human CD235ab | HIR2 | FC |
Spark Blue™ 550 anti-human CD235ab (Flexi-Fluor™) | HIR2 | FC |
Spark Blue™ 574 anti-human CD235ab (Flexi-Fluor™) Antibody | HIR2 | FC |
Spark Red™ 718 anti-human CD235ab (Flexi-Fluor™) | HIR2 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD235ab
Human red blood cells stained with HIR2 APC -
PE anti-human CD235ab
Human red blood cells stained with CD235a/b PE -
PE/Cyanine5 anti-human CD235ab
Human red blood cells stained with HIR2 PE/Cyanine5 -
Purified anti-human CD235ab
Human red blood cells stained with CD235a/b PE IHC staining of purified anti-human CD235ab antibody (clone ... SeqIF™ (sequential immunofluorescence) staining on COMET™ of... -
FITC anti-human CD235ab
Human peripheral red blood cells stained with HIR2 FITC -
Pacific Blue™ anti-human CD235ab
Human erythrocytes stained with HIR2 Pacific Blue™ -
PerCP/Cyanine5.5 anti-human CD235ab
Human red blood cells were stained with anti-human CD235ab ... -
Purified anti-human CD235ab (Maxpar® Ready)
-
Biotin anti-human CD235ab
Human peripheral blood red cells were stained with biotinyla... -
PE/Cyanine7 anti-human CD235ab
Human erythrocytes were first treated with Human TruStain Fc... -
APC/Fire™ 750 anti-human CD235ab
Human erythrocytes were first treated with Human TruStain Fc... -
TotalSeq™-A0196 anti-human CD235ab
-
TotalSeq™-C0196 anti-human CD235ab
-
TotalSeq™-B0196 anti-human CD235ab
-
TotalSeq™-D0196 anti-human CD235ab
-
TotalSeq™-Bn0196 anti-human CD235ab
-
Spark PLUS UV395™ anti-human CD235ab
Human red blood cells were stained with anti-human CD235ab (... -
Spark Blue™ 550 anti-human CD235ab (Flexi-Fluor™)
-
Spark Blue™ 574 anti-human CD235ab (Flexi-Fluor™) Antibody
-
Spark Red™ 718 anti-human CD235ab (Flexi-Fluor™)
Follow Us