TotalSeq™-D0919 anti-human MICA/MICB Antibody

Pricing & Availability
Clone
6D4 (See other available formats)
Regulatory Status
RUO
Other Names
PERB11, MIC, MHC class I chain-related protein A, MICA, PERB11.1, MHC class I chain-related protein B, MICB, PERB11.2
Isotype
Mouse IgG2a, κ
Barcode Sequence
CCCGCAGTATAACGA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
320923 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

6D4 antibody reacts with a common epitope of the human nonclassical MHC class I chain-related protein A (MICA) and B (MICB), also known as PERB11.1 and PERB11.2. The MIC gene is located in MHC class I region. MICA/B are 65-75 kD stress-inducible glycoproteins with highly polymorphic. They are MHC class I-like transmembrane molecules that do not associate β2-microglobulin and do not present peptides. MICA and MICB share 85% identify, and are mainly expressed on Intestinal epithelial cells, epithelial tumor cells, endothelial cells, fibroblasts, and IFN-α-stimulated dendritic cells. MIC molecules bind NKG2D, an activating receptor, and induce activation of NK cells, and subset of CD8+ α/β T cells and γ/δ T cells, as well as suppression of T cell proliferation. MICA/B recognition is involved in the regulation of tumor surveillance, viral infection and autoimmune diseases. The 6D4 antibody is able to block MIC mediated cytotoxicity.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported (for the relevant formats) applications include: immunohistochemistry2,3,5 of acetone-fixed frozen sections and formalin-fixed paraffin-embedded tissue sections, immunoprecipitation7, and blocking2,3 of MIC mediated cytotoxicity. The Ultra-LEAF™ Purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 320919 & 320120).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Groh V, et al. 1999. Science 279:1737.
  2. Groh V, et al. 1999. Proc. Natl. Acad. Sci. USA. 96:6879.
  3. Groh V, et al. 2001. Nature Immunol. 2:255.
  4. Li Z, et al. 2000. Immunogenetics 51:246.
  5. Park EJ, et al. 2003. J. Immunol. 171:4131.
  6. Jinushi M, et al. 2003. J. Immunol. 171:5423.
  7. Wu J, et al. 2003. J. Immunol. 170:4196.
RRID
AB_2894688 (BioLegend Cat. No. 320923)

Antigen Details

Structure
65-75 kD glycoprotein, MHC class I-like transmembrane molecules that do not associate ß2-microglobulin, highly polymorphic
Distribution

Intestinal epithelium, epithelial tumors, endothelial cells, fibroblasts, INF-a-stimulated dendritic cells

Function
Activation of NK cells, subset of CD8+ α/ß T cells and γ/δ T cells, suppression of T cell proliferation
Ligand/Receptor
NKG2D
Cell Type
Dendritic cells, Endothelial cells, Epithelial cells, Fibroblasts
Biology Area
Immunology, Innate Immunity
Molecular Family
MHC Antigens
Antigen References

1. Groh V, et al. 1996. Proc. Natl. Acad. Sci. USA. 93:12445.
2. Groh V, et al. 1999. Proc. Natl. Acad. Sci. USA. 96:6879.
3. Jinushi M, et al. 2003. J. Immunol. 170:1249.
4. Kriegeskorte AK, et al. 2005. Proc. Natl. Acad. Sci. USA. 102:11805.
5. Groh V, et al. 1999. Science 279:1737.

Gene ID
100507436 View all products for this Gene ID 4277 View all products for this Gene ID
UniProt
View information about MICA MICB on UniProt.org
Go To Top Version: 1    Revision Date: 08.12.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account