Loading...

TotalSeq™-D1170 anti-human CD210 (IL-10 R) Antibody

Pricing & Availability
Clone
3F9 (See other available formats)
Regulatory Status
RUO
Workshop
VII 70502
Other Names
IL-10 Receptor, IL-10R
Isotype
Rat IgG2a, κ
Barcode Sequence
TCCCTAGTAGTATAG
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
308819 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD210, also known as the IL-10 receptor, is a 90-110 kD protein expressed on T cells, B cells, NK cells, monocytes and macrophages. CD210 belongs to the class II cytokine receptor family which includes the IFN-γ receptor (CDw119), the IFN-α/β receptor (CD118) and tissue factor (CD142). The IL-10 receptor is involved in signal transduction by inducing phosphorylation of STAT1a and STAT3 and by inducing activation of Jak1 and Tyk.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
shIL-10R
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone 3F9 recognizes the IL-10-binding epitope of IL-10R1.8 Additional reported applications (for the relevant formats) include: immunoprecipitation1, in vitro blocking1-3 of human IL-10 binding to IL-10R. For most successful immunofluorescent staining results, it may be important to maximize signal over background by using a relatively bright fluorochrome-antibody conjugate (Cat. No. 308804) or by using a high sensitivity, three-layer staining technique (e.g., including a biotinylated anti-rat IgG second step), followed by SAv-PE (Cat. No. 405204). The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for highly sensitive assays (Cat. No. 308817 and 308818).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Liu Y, et al. 1997. J. Immunol. 158:604. (Immunogen, IP, Block)
  2. Levings MK, et al. 2005. Blood 105:1162. (Block)
  3. Goodier MR, et al. 2000. J. Immunol. 165:139. (Block)
  4. Huang YH, et al. 2009. J. Leukoc. Biol. 86:273. PubMed
  5. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  6. Liu BS,et al. 2011. J Leukoc Biol. 89:981. PubMed
  7. Joffe M, et al. 2012. Int Immunol. 24:447. PubMed
  8. MacDonald KP, et al. 1999. J. Immunol. 163:5599. (epitope)
RRID
AB_2894594 (BioLegend Cat. No. 308819)

Antigen Details

Structure
Ig superfamily, class II cytokine receptor family, transmembrane glycoprotein, 90-110 kD
Distribution

T cells and B cells, NK cells, monocytes, macrophages

Function
Activates STAT1, STAT3, Jak1, Tyk
Ligand/Receptor
IL-10
Cell Type
B cells, Macrophages, Monocytes, NK cells, T cells
Biology Area
Immunology
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Kotenko S. 2002. Cytokine Growth Factor Rev. 13:223.
2. Trinchieri G. 2003. Nat. Rev. Immunol. 3:133.

Gene ID
3587 View all products for this Gene ID
UniProt
View information about CD210 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 06.25.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account