TotalSeq™-D0123 anti-human CD326 (Ep-CAM) Antibody

Pricing & Availability
Clone
9C4 (See other available formats)
Regulatory Status
RUO
Other Names
Ep-CAM, tumor associated calcium signal transducer 1, epithelial cell surface antigen, epithelial glycoprotein 2, EGP2, adenocarcinoma associated antigen, TROP1
Isotype
Mouse IgG2b, κ
Barcode Sequence
TTCCGAGCAAGTATC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
324253 10 µg 287€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD326 is also known as Ep-CAM, tumor associated calcium signal transducer 1, epithelial cell surface antigen, epithelial glycoprotein 2, EGP2, adenocarcinoma associated antigen, and TROP1. CD326 is a type I transmembrane protein containing six disulfide bridges and one THYRO domain. This cell surface glycosylated 40 kD protein is highly expressed in bone marrow, colon, lung, and most normal epithelial cells and is expressed on carcinomas of gastrointestinal origin. Recently, it has been reported that CD326 expression occurs during the early steps of erythrogenesis. CD326 functions as a homotypic calcium-independent cell adhesion molecule and is believed to be involved in carcinogenesis by its ability to induce genes involved in cellular metabolism and proliferation. CD326 antigen is an immunotherapeutic target for the treatment of human carcinomas.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
DU.4475 breast carcinoma
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the revelant formats) include: immunofluorescence, immunohistochemistry3, and spatial biology (IBEX)4,5.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Lammers R, et al. 2002. Exp. Hematol. 30:537.
  2. Schultz LD, et al. 2010. P. Natl. Acad. Sci. USA 107:13022. PubMed
  3. Human Protein Atlas http://www.proteinatlas.org/ENSG00000119888/antibody (IHC)
  4. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  5. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID
AB_2927878 (BioLegend Cat. No. 324253)

Antigen Details

Structure
Type I transmembrane protein, contains six disulfide bridges, one THYRO domain, approximate molecular weight 40 kD.
Distribution

Highly expressed in bone marrow, colon, lung, and most normal epithelial cells. Also highly expressed on carcinomas of gastrointestinal origin. Expressed during early erythrogenesis.

Function
Homotypic calcium-independent cell adhesion. CD326 is believed to be involved in carcinogenesis by its ability to induce genes involved in cellular metabolism and proliferation.
Modification
Glycosylated.
Cell Type
Embryonic Stem Cells, Epithelial cells
Biology Area
Cell Biology, Immunology, Stem Cells
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Strnad J, et al. 1989. Cancer Res. 49:314.
2. Munz M, et al. 2004. Oncogene 23:5748.
3. Rao CG, et al. 2005. Int. J. Oncol. 27:49.

Gene ID
4072 View all products for this Gene ID
UniProt
View information about CD326 on UniProt.org

Other Formats

View All CD326 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD326 (EpCAM) 9C4 FC,ICC,IHC
FITC anti-human CD326 (EpCAM) 9C4 FC
PE anti-human CD326 (EpCAM) 9C4 FC
APC anti-human CD326 (EpCAM) 9C4 FC
Alexa Fluor® 488 anti-human CD326 (EpCAM) 9C4 FC,SB
Alexa Fluor® 647 anti-human CD326 (EpCAM) 9C4 FC,ICC,SB
PerCP/Cyanine5.5 anti-human CD326 (EpCAM) 9C4 FC,SB
Biotin anti-human CD326 (EpCAM) 9C4 FC
Pacific Blue™ anti-human CD326 (EpCAM) 9C4 FC
Brilliant Violet 421™ anti-human CD326 (EpCAM) 9C4 FC
PE/Cyanine7 anti-human CD326 (EpCAM) 9C4 FC
Brilliant Violet 605™ anti-human CD326 (EpCAM) 9C4 FC
Brilliant Violet 650™ anti-human CD326 (EpCAM) 9C4 FC
Alexa Fluor® 594 anti-human CD326 (EpCAM) 9C4 IHC-P,ICC,SB
Purified anti-human CD326 (EpCAM) (Maxpar® Ready) 9C4 FC,CyTOF®
PE/Dazzle™ 594 anti-human CD326 (EpCAM) 9C4 FC
APC/Fire™ 750 anti-human CD326 (EpCAM) 9C4 FC
Brilliant Violet 510™ anti-human CD326 (EpCAM) 9C4 FC
Brilliant Violet 785™ anti-human CD326 (EpCAM) 9C4 FC
Brilliant Violet 711™ anti-human CD326 (Ep-CAM) 9C4 FC
TotalSeq™-A0123 anti-human CD326 (Ep-CAM) 9C4 PG
APC/Cyanine7 anti-human CD326 (Ep-CAM) 9C4 FC
Alexa Fluor® 700 anti-human CD326 (EpCAM) 9C4 FC
TotalSeq™-C0123 anti-human CD326 (Ep-CAM) 9C4 PG
TotalSeq™-B0123 anti-human CD326 (Ep-CAM) 9C4 PG
PE/Cyanine5 anti-human CD326 (Ep-CAM) 9C4 FC
TotalSeq™-D0123 anti-human CD326 (Ep-CAM) 9C4 PG
Spark UV™ 387 anti-human CD326 (Ep-CAM) 9C4 FC
Spark Red™ 718 anti-human CD326 (Ep-CAM) (Flexi-Fluor™) 9C4 FC
Spark Blue™ 574 anti-human CD326 (Ep-CAM) (Flexi-Fluor™) 9C4 FC
Spark Blue™ 550 anti-human CD326 (Ep-CAM) (Flexi-Fluor™) 9C4 FC
Go To Top Version: 1    Revision Date: 09.12.2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account