- Clone
- BJ40 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Blast-1, SLAMF2, HuLy-m3
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CTACGACGTAGAAGA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
336721 | 10 µg | £245 |
CD48 is a 40-47 kD GPI-anchored membrane protein, also known as Blast-1 and HuLy-m3. It is a member of the CD2 family that contains 2 IgSF domains and is widely expressed on both resting and activated hematopoietic cells with the exception of granulocytes, platelets, and erythrocytes. CD48 binds to CD2 at a considerably (>100-fold) lower affinity than CD58. It is thought to contribute to T cell activation. The cytoplasmic tail of CD48 has been shown to bind to the kinases Lck and Fyn.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunoprecipitation.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Kishimoto T, et al. 1997. Leucocyte Typing VI:White Cell Differentiation Antigens. Garland Publishing Inc.
- Wang R, et al. 2012. J. Leukoc Biol. 91:299. PubMed
- RRID
-
AB_2924540 (BioLegend Cat. No. 336721)
Antigen Details
- Structure
- CD2 family, contains 2 IgSF domains, GPI-membrane anchored, 40-47 kD
- Distribution
-
Widely expressed on hematopoietic cells except granulocytes, platelets, and erythrocytes. Increased on T and B cells after activation
- Function
- Contributes to T cell antigen recognition
- Ligand/Receptor
- CD2
- Cell Targets
- Lck, Fyn interact with cytoplasmic domain
- Cell Type
- B cells
- Biology Area
- Immunology
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
- Fisher RC and Thorley-Lawson DA. 1991. Mol. Cell. Biol. 11:1614.
- Korinek V, et al. 1991. Immunogenetics 33:108.
- Leukocyte Typing IV. Knapp W, et al. (Eds) Oxford University Press (1989)
- Leukocyte Typing V. Schlossman S, et al. (Eds) Oxford University Press (1995)
- Gene ID
- 962 View all products for this Gene ID
- UniProt
- View information about CD48 on UniProt.org
Other Formats
View All CD48 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD48 | BJ40 | FC,IP |
FITC anti-human CD48 | BJ40 | FC |
PE anti-human CD48 | BJ40 | FC |
TotalSeq™-A0029 anti-human CD48 | BJ40 | PG |
TotalSeq™-C0029 anti-human CD48 | BJ40 | PG |
PerCP/Cyanine5.5 anti-human CD48 | BJ40 | FC |
APC anti-human CD48 | BJ40 | FC |
PE/Cyanine7 anti-human CD48 | BJ40 | FC |
TotalSeq™-B0029 anti-human CD48 | BJ40 | PG |
TotalSeq™-D0029 anti-human CD48 | BJ40 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
Follow Us