TotalSeq™-D0055 anti-human CD138 (Syndecan-1) Antibody, CD138, MI15

Pricing & Availability

Clone: MI15 (See other available formats)
Regulatory Status: RUO
Workshop: HCDM listed
Other Names: B-B4
Isotype: Mouse IgG1, κ
Barcode Sequence: ACTCTTTCGTTTACG
Ave. Rating: Submit a Review
Product Citations: publications

Compare all formats

Cat #

Size

Price

Quantity Check Availability

Save

356545

10 µg

£253

Check Availability

Need larger quantities of this item?
Request Bulk Quote

Description

CD138, a member of the syndecan protein family, is a type I integral membrane heparin sulfate proteoglycan also known as Syndecan-1. Syndecan-1 participates in cell proliferation, cell migration, and cell-matrix adhesion via interaction with collagen, fibronectin, and other soluble molecules (such as FGF-basic). It is expressed on normal and malignant human plasma cells, pre-B cells, epithelial cells, and endothelial cells, but not on mature circulating B-lymphocytes. It is also expressed on some non-hematopoietic cells, including embryonic mesenchymal cells, vascular smooth muscle cells, endothelial cells, and neural cells.

Product Details

Technical Data Sheet (pdf)

Product Details

Verified Reactivity

Human

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

A mixture of U266 and XG-1 human myeloma cell lines.

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.

Concentration

0.5 mg/mL

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Application Notes

The epitope recognized by MI15 is found within the ectodomain of the CD138 core protein. It has been reported that MI15 blocks the binding of clone B-B4 but not clone DL-101 by flow cytometric analysis. Clones DL-101 and MI15 exhibit differential staining patterns on in vitro generated plasma cells and some CD138⁺ cell lines.⁴

Additional reported applications for the relevant formats include: immunofluorescent staining¹, Western blotting², immunohistochemical staining of formalin-fixed paraffin-embedded frozen tissue sections³, and spatial biology (IBEX)^5,6.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References (PubMed link indicates BioLegend citation)

Costes V, et al. 1999. Hum. Pathol. 30:1405. (IF)
Gattei V, et al. 1999. Br. J. Haematol. 104:152. (WB)
Bologna-Molina R, et al. 2008. Oral Oncol. 44:805. (IHC)
Itoua MR, et al. 2014. Biomed. Res. Int. 2014:536482.
Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed

RRID

AB_2904378 (BioLegend Cat. No. 356545)

Antigen Details

Structure: 100-200 kD type I integral transmembrane glycoprotein
Distribution: Plasma cells, pre-B cells, epithelial cells, endothelial cells
Function: Adhesion, controls cell morphology, regulates cell growth
Ligand/Receptor: FGFb, collagen, fibronectin
Cell Type: B cells, Endothelial cells, Epithelial cells, Plasma cells
Biology Area: Cell Adhesion, Cell Biology, Cell Motility/Cytoskeleton/Structure, Immunology, Neuroscience, Synaptic Biology
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Sanderson RD, et al. 1992. Cell. Regul. 1:27.
2. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules: The CD Markers. Wiley-Liss A John Wiley & Sons Inc, Publication.
Gene ID: 6382 View all products for this Gene ID
UniProt: View information about CD138 on UniProt.org

Documentation

Reviews

Review This Product

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Related Pages & Pathways

Pathways

B cell Development and Activation

Related FAQs

Other Formats

View All CD138 Reagents Request Custom Conjugation

Description	Clone	Applications
PE anti-human CD138 (Syndecan-1)	MI15	FC,SB
Purified anti-human CD138 (Syndecan-1)	MI15	FC,ICC,WB,IHC-P,SB
APC anti-human CD138 (Syndecan-1)	MI15	FC
FITC anti-human CD138 (Syndecan-1)	MI15	FC,SB
PerCP/Cyanine5.5 anti-human CD138 (Syndecan-1)	MI15	FC
Alexa Fluor® 700 anti-human CD138 (Syndecan-1)	MI15	FC
PE/Cyanine7 anti-human CD138 (Syndecan-1)	MI15	FC
Brilliant Violet 421™ anti-human CD138 (Syndecan-1)	MI15	FC
Brilliant Violet 510™ anti-human CD138 (Syndecan-1)	MI15	FC
Brilliant Violet 605™ anti-human CD138 (Syndecan-1)	MI15	FC
Brilliant Violet 711™ anti-human CD138 (Syndecan-1)	MI15	FC
Alexa Fluor® 647 anti-human CD138 (Syndecan-1)	MI15	FC,SB
Alexa Fluor® 594 anti-human CD138 (Syndecan-1)	MI15	ICC
PE/Dazzle™ 594 anti-human CD138 (Syndecan-1)	MI15	FC
APC/Cyanine7 anti-human CD138 (Syndecan-1)	MI15	FC
Pacific Blue™ anti-human CD138 (Syndecan-1)	MI15	FC
TotalSeq™-A0055 anti-human CD138 (Syndecan-1)	MI15	PG
Brilliant Violet 785™ anti-human CD138 (Syndecan-1)	MI15	FC
Biotin anti-human CD138 (Syndecan-1)	MI15	FC
TotalSeq™-C0055 anti-human CD138 (Syndecan-1)	MI15	PG
APC/Fire™ 750 anti-human CD138 (Syndecan-1)	MI15	FC
TotalSeq™-B0055 anti-human CD138 (Syndecan-1)	MI15	PG
PE/Cyanine5 anti-human CD138 (Syndecan-1)	MI15	FC
TotalSeq™-D0055 anti-human CD138 (Syndecan-1)	MI15	PG
PE/Fire™ 640 anti-human CD138 (Syndecan-1)	MI15	FC
Spark Violet™ 500 anti-human CD138 (Syndecan-1)	MI15	FC
FITC anti-human CD138	MI15	FC
PE/Fire™ 700 anti-human CD138 (Syndecan-1)	MI15	FC
Spark Violet™ 423 anti-human CD138 (Syndecan-1)	MI15	FC
Spark Red™ 718 anti-human CD138 (Syndecan-1) (Flexi-Fluor™)	MI15	FC
GMP FITC anti-human CD138 (Syndecan-1)	MI15	FC
Brilliant Violet 650™ anti-human CD138 (Syndecan-1)	MI15	FC

Certificate of Analysis

Go To Top Version: 1 Revision Date: 12/14/2021

For Research Use Only. Not for diagnostic or therapeutic use.

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.