Loading...

TotalSeq™-D0071 anti-human CD194 (CCR4) Antibody

Pricing & Availability
Clone
L291H4 (See other available formats)
Regulatory Status
RUO
Other Names
CKR4, K5-5, CMKBR4, ChemR13, CC-CKR-4, MGC88293, HGCN:14099
Isotype
Mouse IgG1, κ
Barcode Sequence
AGCTTACCTGCACGA
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
359431 10 µg £253
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD194, also known as CCR4, is a CC chemokine receptor. It binds CCL17 and CCL22 and is expressed on a subset of T and B cells, basophils, monocytes, and NK cells. Human Th2 cells are characterized by the expression of CCR4 and CCR8, and these receptors are regulated differently during Th2 development. Human peripheral blood Tregs can be divided into two distinct populations based on the expression of CCR4. Freshly isolated Tregs express CCR4 and presumably represent memory-type Tregs, and CCR4- Tregs require CD3-mediated activation to acquire a regulatory activity. Depletion of CCR4+ T cells leads to Th1-type polarization of CD4+ T cells and augmentation of CD8+ T cell responses to tumor antigens. CCR4 and its ligands are important for the recruitment of memory T cells into the skin in various cutaneous immune diseases.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
Cynomolgus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human CCR4 transfected cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna.

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2894569 (BioLegend Cat. No. 359431)

Antigen Details

Structure
GPCR, seven transmembrane receptor
Distribution

Expressed on a subset of T and B cells, basophils, monocytes, NK cells

Function
Migration of inflammatory and regulatory cells to the target tissues
Ligand/Receptor
CCL17 and CCL22
Cell Type
B cells, Basophils, Embryonic Stem Cells, Monocytes, NK cells, T cells, Tregs
Biology Area
Immunology, Innate Immunity, Stem Cells
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References

1. Katschke KJ, et al. 2001 Arthritis Rheum. 44:1022.
2. Colantonio L, et al. 2002 Eur. J. Immunol. 32:1264.
3. Jakubzick C et al. 2004 Am. J. Pathol. 165:1211.
4. Morimoto Y, et al. 2005 J. Leukoc. Biol. 78:753.
5. Baatar J, et al. 2007 J. Immunol. 178:4891.
6. Kusumoto M, et al. 2007 J. Interferon. Cytokine Res. 27:901.

Gene ID
1233 View all products for this Gene ID
UniProt
View information about CD194 on UniProt.org

Related FAQs

Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?

Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.

Go To Top Version: 1    Revision Date: 09/08/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account