- Clone
- L291H4 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CKR4, K5-5, CMKBR4, ChemR13, CC-CKR-4, MGC88293, HGCN:14099
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AGCTTACCTGCACGA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
359431 | 10 µg | £253 |
CD194, also known as CCR4, is a CC chemokine receptor. It binds CCL17 and CCL22 and is expressed on a subset of T and B cells, basophils, monocytes, and NK cells. Human Th2 cells are characterized by the expression of CCR4 and CCR8, and these receptors are regulated differently during Th2 development. Human peripheral blood Tregs can be divided into two distinct populations based on the expression of CCR4. Freshly isolated Tregs express CCR4 and presumably represent memory-type Tregs, and CCR4- Tregs require CD3-mediated activation to acquire a regulatory activity. Depletion of CCR4+ T cells leads to Th1-type polarization of CD4+ T cells and augmentation of CD8+ T cell responses to tumor antigens. CCR4 and its ligands are important for the recruitment of memory T cells into the skin in various cutaneous immune diseases.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Cynomolgus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human CCR4 transfected cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna.
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2894569 (BioLegend Cat. No. 359431)
Antigen Details
- Structure
- GPCR, seven transmembrane receptor
- Distribution
-
Expressed on a subset of T and B cells, basophils, monocytes, NK cells
- Function
- Migration of inflammatory and regulatory cells to the target tissues
- Ligand/Receptor
- CCL17 and CCL22
- Cell Type
- B cells, Basophils, Embryonic Stem Cells, Monocytes, NK cells, T cells, Tregs
- Biology Area
- Immunology, Innate Immunity, Stem Cells
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors, GPCR
- Antigen References
-
1. Katschke KJ, et al. 2001 Arthritis Rheum. 44:1022.
2. Colantonio L, et al. 2002 Eur. J. Immunol. 32:1264.
3. Jakubzick C et al. 2004 Am. J. Pathol. 165:1211.
4. Morimoto Y, et al. 2005 J. Leukoc. Biol. 78:753.
5. Baatar J, et al. 2007 J. Immunol. 178:4891.
6. Kusumoto M, et al. 2007 J. Interferon. Cytokine Res. 27:901. - Gene ID
- 1233 View all products for this Gene ID
- UniProt
- View information about CD194 on UniProt.org
Related FAQs
- Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?
-
Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.
Other Formats
View All CD194 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PerCP/Cyanine5.5 anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Purified anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with purifie... -
Alexa Fluor® 647 anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with CD3 PE ... -
APC anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
PE/Cyanine7 anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
PE anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Brilliant Violet 421™ anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Brilliant Violet 510™ anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Brilliant Violet 605™ anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
PE/Dazzle™ 594 anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with CD3 APC... -
Biotin anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with CD3 APC... -
TotalSeq™-A0071 anti-human CD194 (CCR4)
-
TotalSeq™-C0071 anti-human CD194 (CCR4)
-
TotalSeq™-B0071 anti-human CD194 (CCR4)
-
APC/Fire™ 750 anti-human CD194 (CCR4) Antibody
Human peripheral blood lymphocytes were stained with CD3 FIT... -
PE/Fire™ 810 anti-human CD194 (CCR4) Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Fire™ 700 anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with anti-hu... -
TotalSeq™-D0071 anti-human CD194 (CCR4)
-
KIRAVIA Blue 520™ anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with anti-hu... -
APC/Fire™ 810 anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Fire™ 780 anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with anti-hu... -
Alexa Fluor® 700 anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Fire™ 806 anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark Red™ 718 anti-human CD194 (CCR4) (Flexi-Fluor™)
-
Brilliant Violet 785™ anti-human CD194 (CCR4)
Human peripheral blood lymphocytes were stained with anti-hu...
Follow Us