TotalSeq™-D0144 anti-human CD185 (CXCR5) Antibody

Pricing & Availability
Clone
J252D4 (See other available formats)
Regulatory Status
RUO
Other Names
BLR1, MDR15
Isotype
Mouse IgG1, κ
Barcode Sequence
AATTCAACCGTCGCC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
356949 10 µg £253
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD185, also known as CXCR5, is a 42 kD G-protein coupled receptor with seven transmembrane regions. CXCR5 is expressed by mature B cells, follicular helper T cells, Burkitt’s lymphoma cells and a subset of neurons, and mediates cell migration to the B cell follicles in the secondary lymphoid organs. The ligand of CXCR5 is CXCL13 (BLC).

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human CXCR5-transfected cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2894546 (BioLegend Cat. No. 356949)

Antigen Details

Structure
G-protein coupled receptor, 7 transmembrane regions, 42 kD
Distribution

Mature B cells, Follicular helper T cells, and Burkitt's lymphoma cells.

Function
Mediates cell migration to the B cell follicles in the secondary lymphoid organs
Ligand/Receptor
CXCL13
Cell Type
B cells, Tfh
Biology Area
Cell Biology, Immunology, Neuroinflammation, Neuroscience
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References

1. Ma CS, et al. 2012. J. Exp. Med. 209:1241.
2. León B, et al. 2012. Nat. Immunol. 13:681.
3. Crotty S. 2011. Annu. Rev. Immunol. 29:621.
4. Kerfoot SM, et al. 2011. Immunity 34:947.
5. Sáez de Guinoa J, et al. 2011. Blood 118:1560.

Gene ID
643 View all products for this Gene ID
UniProt
View information about CD185 on UniProt.org

Related FAQs

Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?

Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.

Other Formats

View All CD185 Reagents Request Custom Conjugation
Description Clone Applications
PE anti-human CD185 (CXCR5) J252D4 FC
APC anti-human CD185 (CXCR5) J252D4 FC
Purified anti-human CD185 (CXCR5) J252D4 FC
Alexa Fluor® 647 anti-human CD185 (CXCR5) J252D4 FC
PerCP/Cyanine5.5 anti-human CD185 (CXCR5) J252D4 FC
Alexa Fluor® 488 anti-human CD185 (CXCR5) J252D4 FC
FITC anti-human CD185 (CXCR5) J252D4 FC
Alexa Fluor® 700 anti-human CD185 (CXCR5) J252D4 FC
Pacific Blue™ anti-human CD185 (CXCR5) J252D4 FC
Brilliant Violet 421™ anti-human CD185 (CXCR5) J252D4 FC
PE/Cyanine7 anti-human CD185 (CXCR5) J252D4 FC
APC/Cyanine7 anti-human CD185 (CXCR5) J252D4 FC
PE/Dazzle™ 594 anti-human CD185 (CXCR5) J252D4 FC
Brilliant Violet 605™ anti-human CD185 (CXCR5) J252D4 FC
Biotin anti-human CD185 (CXCR5) J252D4 FC
Brilliant Violet 711™ anti-human CD185 (CXCR5) J252D4 FC
Brilliant Violet 785™ anti-human CD185 (CXCR5) J252D4 FC
TotalSeq™-A0144 anti-human CD185 (CXCR5) J252D4 PG
TotalSeq™-C0144 anti-human CD185 (CXCR5) J252D4 PG
Brilliant Violet 750™ anti-human CD185 (CXCR5) J252D4 FC
TotalSeq™-B0144 anti-human CD185 (CXCR5) J252D4 PG
APC/Fire™ 750 anti-human CD185 (CXCR5) J252D4 FC
Spark NIR™ 685 anti-human CD185 (CXCR5) J252D4 FC
TotalSeq™-D0144 anti-human CD185 (CXCR5) J252D4 PG
PE/Cyanine5 anti-human CD185 (CXCR5) J252D4 FC
PE/Fire™ 700 anti-human CD185 (CXCR5) Antibody J252D4 FC
APC/Fire™ 810 anti-human CD185 (CXCR5) Antibody J252D4 FC
PerCP/Fire™ 806 anti-human CD185 (CXCR5) J252D4 FC
PerCP/Fire™ 780 anti-human CD185 (CXCR5) J252D4 FC
Spark Red™ 718 anti-human CD185 (CXCR5) J252D4 FC
APC anti-human CD185 J252D4 FC
Brilliant Violet 510™ anti-human CD185 (CXCR5) J252D4 FC
Brilliant Violet 650™ anti-human CD185 (CXCR5) J252D4 FC
Go To Top Version: 1    Revision Date: 07/07/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account