- Clone
- C1.7 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- VII 70350
- Other Names
- 2B4, SLAMF4
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TCGCTTGGATGGTAG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
329541 | 10 µg | £253 |
CD244, known as 2B4, is a 38 kD type I transmembrane protein. It is a member of the CD2 subset of the immunoglobulin superfamily (IgSF) molecules. CD244 is expressed on NK cells, a subset of T cells (including most CD8+ T cells and γ/δ T cells), monocytes, basophils, and eosinophils. CD48 is the ligand of CD244. It has been reported that ligation of human CD244 results in enhanced NK cell cytotoxicity and cytokine production. Recent studies have shown that human CD244, like murine CD244, has both activating and inhibitory functions, which are dependent on the density of surface 2B4 expression, degree of ligation, and the level of the adaptor molecule SAP expression.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: inducing cytokine production by NK cells, enhancing NK cytotoxicity, and Western blotting.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) - RRID
-
AB_2894670 (BioLegend Cat. No. 329541)
Antigen Details
- Structure
- 38 kD type I transmembrane protein, CD2 family member, Ig superfamily
- Distribution
-
NK, T subset, monocytes, basophils, and eosinophils
- Function
- Activation and inhibition of NK cell function
- Ligand/Receptor
- CD48
- Cell Type
- Basophils, Eosinophils, Monocytes, NK cells, T cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Lee KM, et al. 2003. J. Immunol. 170:4881.
2. Chlewicki LK, et al. 2008. J. Immunol. 180:8159.
3. Messmer B, et al. 2006. J. Immunol. 176:4646.
4. Boles KS, et al. 2001. Immunol. Rev. 181:234. - Gene ID
- 51744 View all products for this Gene ID
- UniProt
- View information about CD244 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD244 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD244 (2B4)
-
Biotin anti-human CD244 (2B4)
-
FITC anti-human CD244 (2B4)
-
PE anti-human CD244 (2B4)
-
Alexa Fluor® 647 anti-human CD244 (2B4)
-
APC anti-human CD244 (2B4)
-
PerCP/Cyanine5.5 anti-human CD244 (2B4)
-
APC/Cyanine7 anti-human CD244 (2B4)
-
PE/Cyanine7 anti-human CD244 (2B4)
-
PE/Dazzle™ 594 anti-human CD244 (2B4)
-
Pacific Blue™ anti-human CD244 (2B4)
-
Alexa Fluor® 700 anti-human CD244 (2B4)
-
TotalSeq™-A0189 anti-human CD244 (2B4)
-
TotalSeq™-C0189 anti-human CD244 (2B4)
-
Brilliant Violet 421™ anti-human CD244 (2B4)
-
Brilliant Violet 510™ anti-human CD244 (2B4)
-
Brilliant Violet 605™ anti-human CD244 (2B4)
-
TotalSeq™-B0189 anti-human CD244 (2B4)
-
PE/Cyanine5 anti-human CD244 (2B4)
-
TotalSeq™-D0189 anti-human CD244 (2B4)
-
PE/Fire™ 700 anti-human CD244 (2B4)
-
Spark Blue™ 550 anti-human CD244 (2B4) (Flexi-Fluor™)
Follow Us