- Clone
- IP26 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- α/β TCR, TCR α/β
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CGTAACGTAGAGCGA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
306751 | 10 µg | £253 |
The IP26 antibody reacts with a monomorphic determinant of the α/β T-cell receptor, which is expressed on greater than 95% of normal peripheral blood CD3+ T cells. The α/β TCR recognizes a peptide bound to MHC leading to T-cell activation.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: T cell activation. When co-staining with anti-CD3, we recommend using clone UCHT1, since we have confirmed that IP26 does not compete with this clone. Other anti-CD3 clones may compete out the binding of IP26.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) - RRID
-
AB_2892369 (BioLegend Cat. No. 306751)
Antigen Details
- Structure
- Ig superfamily, with CD3 forms CD3/TCR complex
- Distribution
-
T cells, thymocytes
- Function
- Antigen recognition, T cell activation
- Ligand/Receptor
- Peptide bound to MHC
- Cell Type
- T cells, Thymocytes, Tregs
- Biology Area
- Adaptive Immunity, Immunology
- Molecular Family
- TCRs
- Antigen References
-
1. Marchalonis J, et al. 2002. J. Mol. Recognit. 15:260.
- Gene ID
- 6955 View all products for this Gene ID 6957 View all products for this Gene ID
- UniProt
- View information about TCR alpha/beta on UniProt.org
Related FAQs
Other Formats
View All TCR α/β Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Biotin anti-human TCR α/β
-
FITC anti-human TCR α/β
-
PE anti-human α/β T Cell Receptor
-
PE/Cyanine5 anti-human TCR α/β
-
Purified anti-human TCR α/β
-
PE/Cyanine7 anti-human TCR α/β
-
Alexa Fluor® 488 anti-human TCR α/β
-
Alexa Fluor® 647 anti-human TCR α/β
-
Pacific Blue™ anti-human TCR α/β
-
APC anti-human TCR α/β
-
Brilliant Violet 421™ anti-human TCR α/β
-
PerCP/Cyanine5.5 anti-human TCR α/β
-
PE/Dazzle™ 594 anti-human TCR α/β
-
APC/Cyanine7 anti-human TCR α/β
-
Alexa Fluor® 700 anti-human TCR α/β
-
Brilliant Violet 510™ anti-human TCR α/β
-
APC/Fire™ 750 anti-human TCR α/β
-
Brilliant Violet 605™ anti-human TCR α/β
-
TotalSeq™-A0224 anti-human TCR α/β
-
Brilliant Violet 711™ anti-human TCR α/β
-
Brilliant Violet 785™ anti-human TCR α/β
-
TotalSeq™-C0224 anti-human TCR α/β
-
Brilliant Violet 750™ anti-human TCR α/β
-
TotalSeq™-B0224 anti-human TCR α/β
-
PE anti-human TCR α/β
-
APC/Fire™ 810 anti-human TCR α/β
-
TotalSeq™-D0224 anti-human TCR α/β
-
GMP PE anti-human TCR α/β
-
Spark Red™ 718 anti-human TCR α/β (Flexi-Fluor™)
-
Brilliant Violet 650™ anti-human TCR α/β
-
FITC anti-human TCR α/β
Follow Us