- Clone
- LNH-94; A17082E;
- Regulatory Status
- RUO
- Other Names
- Na+/K+ ATPase β3, ATP1B3, β2M, β2-M, beta2-microglobulin b2-M, b2M
- Isotype
- Mouse IgG1, κ (all clones)
- Barcode Sequence
- GTCAACTCTTTAGCG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
394602 | 10 µg | £253 |
TotalSeq™ anti-human Hashtag reagents are designed to label most human cells, using a combination of two clones that recognize CD298 and β2 microglobulin, respectively. The antibodies are conjugated to the same oligonucleotide, pre-mixed to be used following an optimized protocol similar to the CITE-seq workflow.
β2-microglobulin (β2M) is a 12 kD nonpolymorphic Ig like protein. It is a non-membrane-anchored glycoprotein and is noncovalently associated with 39-44 kD polymorphic heavy chains of MHC class I molecules to form HLA class I antigen complex. In association with HLA class I, β2M is expressed on all leukocytes, platelets, endothelial cells, and epithelial cells. β2M plays an essential role both in governing MHC class I molecules stability and in promoting antigen binding and presenting the antigen to CD3/TCR complex of CD8+ T cells.
CD298 or the β3 Na+/K+ ATPase, is a 42 kD type II transmembrane protein, also known as ATP1B3. An integral plasma membrane protein, Na+/K+ ATPase is composed of one α and one β subunits. Four isoforms of the α and three isoforms of the β subunits have been reported. Na+/K+ ATPase couples ATP hydrolysis to the development of an ionic gradient by pumping Na+ and K+ ions in opposite directions across the cell plasma membrane. It has broad tissue distribution, including all leukocytes and many other tissues.
Product Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_3097628 (BioLegend Cat. No. 394602)
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
TotalSeq™-D0251 anti-human Hashtag 1 | LNH-94; A17082E | PG |
TotalSeq™-D0252 anti-human Hashtag 2 | LNH-94; A17082E | PG |
TotalSeq™-D0253 anti-human Hashtag 3 | LNH-94; A17082E | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
TotalSeq™-D0251 anti-human Hashtag 1
-
TotalSeq™-D0252 anti-human Hashtag 2
-
TotalSeq™-D0253 anti-human Hashtag 3
Follow Us