- Clone
- TS1/8 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V S025
- Other Names
- LFA-2, T11, SRBC-R
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TACGATTTGTCAGGG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
309239 | 10 µg | £253 |
CD2 is a 50 kD type I transmembrane glycoprotein also known as LFA-2, T11, and sheep red blood cell receptor (SRBC-R). This immunoglobulin superfamily member is expressed on thymocytes, T lymphocytes, NK cells, and thymic B cell subsets. The major ligand for CD2 is CD58 (also known as LFA-3). CD2 has also been reported to bind CD48, CD59, and CD15. CD2 plays a critical role in alternative T cell activation, T cell signaling, and cell-cell adhesion.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: blocking of T cell activation, and partial blocking of B cell costimulation2. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 309235 & 309236).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Schlossman S, et al. Eds.1995. Leucocyte Typing V Oxford University Press. New York.
- Hughes CCW, et al. 1996. J. Biol. Chem. 271:5369.
- RRID
-
AB_2894548 (BioLegend Cat. No. 309239)
Antigen Details
- Structure
- Ig superfamily, type I transmembrane glycoprotein, 50 kD
- Distribution
-
T cells, NK cells, thymocytes, and thymic B cell subsets
- Function
- T cell activation, adhesion
- Ligand/Receptor
- CD58 (LFA-3), CD48, CD59, CD15
- Cell Type
- B cells, NK cells, T cells, Thymocytes
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Bell G, et al. 1995. J. Immunol. 155:2805.
2. Bierer B, et al. 1989. Annu. Rev. Immunol. 7:579.
3. Moingeon P, et al. 1989. Immunol. Rev. 111:111. - Gene ID
- 914 View all products for this Gene ID
- UniProt
- View information about CD2 on UniProt.org
Other Formats
View All CD2 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
FITC anti-human CD2
Human peripheral blood lymphocytes stained with TS1/8 FITC -
PE anti-human CD2
Whole blood lymphocytes stained with TS1/8 PE -
Purified anti-human CD2
Human peripheral blood lymphocytes stained with purified TS1... -
Pacific Blue™ anti-human CD2
Human peripheral blood lymphocytes stained with TS1/8 Pacifi... -
PE/Cyanine7 anti-human CD2
Human peripheral blood lymphocytes stained with TS1/8 PE/Cya... -
Brilliant Violet 421™ anti-human CD2
Human peripheral blood lymphocytes stained with (clone TS1/8... -
Purified anti-human CD2 (Maxpar® Ready)
Human PBMCs stained with 151Eu anti-CD2 (TS1/8) and 170Er an... -
PerCP/Cyanine5.5 anti-human CD2
Human peripheral blood lymphocytes stained with CD3 Brillian... -
APC anti-human CD2
Human peripheral blood lymphocytes stained with CD3 Brillian... -
APC/Fire™ 750 anti-human CD2
Human peripheral blood lymphocytes stained with CD3 Brillian... -
Alexa Fluor® 700 anti-human CD2
Human peripheral blood lymphocytes stained with CD3 Brillian... -
TotalSeq™-A0367 anti-human CD2
-
TotalSeq™-C0367 anti-human CD2
-
FITC anti-human CD2
Typical results from human peripheral blood lymphocytes stai... -
TotalSeq™-B0367 anti-human CD2
-
Ultra-LEAF™ Purified anti-human CD2
Human peripheral blood lymphocytes stained with Ultra-LEAF™ ... -
APC/Cyanine7 anti-human CD2
Human peripheral blood lymphocytes were stained with anti-hu... -
PE anti-human CD2
Typical results from human peripheral blood lymphocytes stai... -
TotalSeq™-D0367 anti-human CD2
-
PE/Cyanine7 anti-human CD2
Typical results from human peripheral blood lymphocytes stai... -
PerCP/Cyanine5.5 anti-human CD2
Typical results from human peripheral blood lymphocytes stai... -
GMP PE anti-human CD2
Typical results from human peripheral blood lymphocytes stai... -
APC anti-human CD2
Typical results from human peripheral blood lymphocytes stai... -
APC/Fire™ 750 anti-human CD2
Typical results from human peripheral blood lymphocytes stai... -
Pacific Blue™ anti-human CD2
Typical results from human peripheral blood lymphocytes stai... -
GMP FITC anti-human CD2
Typical results from human peripheral blood lymphocytes stai... -
GMP APC/Fire™ 750 anti-human CD2
Typical results from human peripheral blood lymphocytes stai... -
PE/Dazzle™ 594 anti-human CD2
Human peripheral blood lymphocytes were stained with anti-hu...
Follow Us