- Clone
- 5A6 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- S5.7, CVID6, TSPAN28
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GTATCCTTCCTTGGC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
349527 | 10 µg | £253 |
CD81 is a 26 kD non-glycosylated member of the tetraspanin superfamily (TM4SF), also known as TAPA-1 (target of an antiproliferative antibody). CD81 is expressed on T and B cells, NK cells, monocytes, dendritic cells, thymocytes, endothelial cells, and fibroblasts. It also has low levels of expression on granulocytes. CD81 induces B cell adhesion via VLA-4 integrin and has been shown to play a role in early T cell development. CD81 associates with several other cell-surface proteins in a multimolecular complex, including CD19, CD21, CD20, CD37, CD53, and CD82 in B cells, and CD4, CD8, and CD82 in T cells.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human OCI-LY8 cell line
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG – Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: Western Blotting3 and immunoprecipitation2,3.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Van Zelm MC, et al. 2010. J. Clin. Invest. 120:1265.
- Oren R, et al. 1990. Mol. Cell. Biol. 8:4007. (IP)
- Clark K, et al. 2004. J. Biol. Chem. 279(19):19401. (IP, WB)
- Mochida K, et al. 2008. J. Virol. 13:6711.
- Rappa G, et al. 2014. Mol Cancer Res. 12:1840. PubMed
- RRID
-
AB_2910399 (BioLegend Cat. No. 349527)
Antigen Details
- Structure
- 26 kD, type III transmembrane protein, member of the TM4SF tetraspanin family. Complexed with CD82, CD19, CD21, or CD4, CD8.
- Distribution
-
T cells, NK, monocytes, B cells, endothelial and epithelial cells, low on granulocytes.
- Function
- Regulates cell activation and growth and cell aggregation.
- Cell Type
- B cells, Endothelial cells, Epithelial cells, Monocytes, Neural Stem Cells, NK cells, T cells
- Biology Area
- Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Signal Transduction, Stem Cells, Transcription Factors
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
- Van Zelm MC, et al. 2010. J. Clin. Invest. 120:1265.
- Fearon D, et al. 1995. Annu. Rev. Immunol. 13:127.
- Wright M, et al. 1994. Immunol. Today 15:588.
- Gene ID
- 975 View all products for this Gene ID
- UniProt
- View information about CD81 on UniProt.org
Related FAQs
Other Formats
View All CD81 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD81 (TAPA-1) | 5A6 | FC,WB,IP |
FITC anti-human CD81 (TAPA-1) | 5A6 | FC |
PE anti-human CD81 (TAPA-1) | 5A6 | FC |
PerCP/Cyanine5.5 anti-human CD81 (TAPA-1) | 5A6 | FC |
APC anti-human CD81 (TAPA-1) | 5A6 | FC |
PE/Cyanine7 anti-human CD81 (TAPA-1) | 5A6 | FC |
Biotin anti-human CD81 (TAPA-1) | 5A6 | FC |
Pacific Blue™ anti-human CD81 (TAPA-1) | 5A6 | FC |
Alexa Fluor® 700 anti-human CD81 (TAPA-1) | 5A6 | FC |
PE/Dazzle™ 594 anti-human CD81 (TAPA-1) | 5A6 | FC |
TotalSeq™-A0373 anti-human CD81 (TAPA-1) | 5A6 | PG |
TotalSeq™-C0373 anti-human CD81 (TAPA-1) | 5A6 | PG |
TotalSeq™-B0373 anti-human CD81 (TAPA-1) | 5A6 | PG |
TotalSeq™-D0373 anti-human CD81 (TAPA-1) | 5A6 | PG |
FITC anti-human CD81 | 5A6 | FC |
PE/Fire™ 640 anti-human CD81 (TAPA-1) | 5A6 | FC |
Spark YG™ 581 anti-human CD81 (TAPA-1) | 5A6 | FC |
Spark Blue™ 574 anti-human CD81 (TAPA-1) | 5A6 | FC |
Brilliant Violet 785™ anti-human CD81 (TAPA-1) | 5A6 | FC |
GMP FITC anti-human CD81 (TAPA-1) | 5A6 | FC |
Spark Red™ 718 anti-human CD81 (TAPA-1) | 5A6 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD81 (TAPA-1)
-
FITC anti-human CD81 (TAPA-1)
-
PE anti-human CD81 (TAPA-1)
-
PerCP/Cyanine5.5 anti-human CD81 (TAPA-1)
-
APC anti-human CD81 (TAPA-1)
-
PE/Cyanine7 anti-human CD81 (TAPA-1)
-
Biotin anti-human CD81 (TAPA-1)
-
Pacific Blue™ anti-human CD81 (TAPA-1)
-
Alexa Fluor® 700 anti-human CD81 (TAPA-1)
-
PE/Dazzle™ 594 anti-human CD81 (TAPA-1)
-
TotalSeq™-A0373 anti-human CD81 (TAPA-1)
-
TotalSeq™-C0373 anti-human CD81 (TAPA-1)
-
TotalSeq™-B0373 anti-human CD81 (TAPA-1)
-
TotalSeq™-D0373 anti-human CD81 (TAPA-1)
-
FITC anti-human CD81
-
PE/Fire™ 640 anti-human CD81 (TAPA-1)
-
Spark YG™ 581 anti-human CD81 (TAPA-1)
-
Spark Blue™ 574 anti-human CD81 (TAPA-1)
-
Brilliant Violet 785™ anti-human CD81 (TAPA-1)
-
GMP FITC anti-human CD81 (TAPA-1)
-
Spark Red™ 718 anti-human CD81 (TAPA-1)
Follow Us