- Clone
- P30-15 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- NKp30, NCR3, Activating NK receptor NKp30, natural cytotoxicity triggering receptor 3
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AAAGTCACTCTGCCG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
325241 | 10 µg | £253 |
The p30-15 monoclonal antibody recognizes CD337 also known as activating NK receptor NKp30 (NKp30), and natural cytotoxicity triggering receptor 3. NKp30 is a type I transmembrane protein, member of the natural cytotoxicity receptor family that contains one immunoglobulin-like domain. NKp30 has an apparent molecular weight of 30 kD and six isoforms are produced by alternative splicing. NKp30 is expressed on resting and activated NK cells. NKp30 enhances NK cell cytolysis of tumor cellts that are deficient in MHC class I molecules. NKp30 has been shown to associate with CD59 and TCRζ. The p30-15 antibody against human NKp30 has been shown to be useful for flow cytometry, stimulation of human NK cells via NKp30 in a redirected lysis assay, and blocking of NKp30 function in solution.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Recombinant human NKp30
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: ELISA, stimulation of human NK cells via NKp30 in a redirected lysis assay, and blocking of NKp30 function in solution1,3,5. The Ultra-LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 325223 & 325224).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) - RRID
-
AB_2941494 (BioLegend Cat. No. 325241)
Antigen Details
- Structure
- Type I transmembrane protein, member of the natural cytotoxicity receptor family, contains one immunoglobulin-like domain. Approximately 44 kD. Six isoforms produced by alternative splicing.
- Distribution
-
IL-2 activated NK cells and NK cell lines, some γ/δ T cells activated in vitro
- Function
- NK cell triggering of cytolysis toward tumor targets and other target cells deficient in MHC class I molecules
- Interaction
- CD59, TCRζ
- Cell Type
- NK cells, T cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Pende D, et al. 1999. J. Exp. Med. 190:1505.
- Gene ID
- 259197 View all products for this Gene ID
- UniProt
- View information about CD337 on UniProt.org
Related FAQs
Other Formats
View All CD337 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD337 (NKp30)
-
Biotin anti-human CD337 (NKp30)
-
PE anti-human CD337 (NKp30)
-
APC anti-human CD337 (NKp30)
-
Alexa Fluor® 647 anti-human CD337 (NKp30)
-
PerCP/Cyanine5.5 anti-human CD337 (NKp30)
-
PE/Cyanine7 anti-human CD337 (NKp30)
-
Brilliant Violet 711™ anti-human CD337 (NKp30)
-
TotalSeq™-C0801 anti-human CD337 (NKp30)
-
TotalSeq™-A0801 anti-human CD337 (NKp30)
-
Brilliant Violet 785™ anti-human CD337 (NKp30)
-
APC/Fire™ 750 anti-human CD337 (NKp30)
-
Brilliant Violet 421™ anti-human CD337 (NKp30)
-
PE/Dazzle™ 594 anti-human CD337 (NKp30)
-
Ultra-LEAF™ Purified anti-human CD337 (NKp30)
-
TotalSeq™-B0801 anti-human CD337 (NKp30) Antibody
-
Brilliant Violet 605™ anti-human CD337 (NKp30) Antibody
-
KIRAVIA Blue 520™ anti-human CD337 (NKp30)
-
PE/Fire™ 810 anti-human CD337 (NKp30)
-
TotalSeq™-D0801 anti-human CD337 (NKp30)
-
APC/Cyanine7 anti-human CD337 (NKp30)
-
Spark Red™ 718 anti-human CD337 (NKp30) (Flexi-Fluor™)
Follow Us