- Clone
- NY2 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Coagulation Factor III, Tissue Factor (TF), Thromboplastin, platelet tissue factor, factor III, factor 3, F3, F-3, TFA
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CACTGCCGTCGATTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
365213 | 10 µg | £253 |
CD142, also known as Tissue Factor (TF), Coagulation Factor III, and Thromboplastin, is a 45 kD type I transmembrane glycoprotein. It is expressed on the surface of a variety of cells that are physically separated from the circulating blood which include smooth muscle cells, fibroblasts, keratinocytes, glomerular epithelial cells (cytoplasmic inclusions), astrocytes, myocardium, liver stromal cells, pancreas cells, and is also expressed on activated monocytes and stimulated endothelial cells. CD142 is a high-affinity receptor for coagulation factor VII and initiates the extrinsic pathway of blood coagulation. CD142 also plays an important role in a variety of diseases such as sepsis, atherosclerosis, and cancer.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2941538 (BioLegend Cat. No. 365213)
Antigen Details
- Structure
- 45 kD Type I transmembrane glycoprotein.
- Distribution
-
Smooth muscle cells, fibroblasts, keratinocytes, glomerular epithelial cells, astrocytes, myocardium, liver stromal cells, pancreas cell, stimulated endothelial cells, stimulated monocytes
- Function
- Blood coagulation
- Ligand/Receptor
- Coagulation Factor VII
- Cell Type
- Astrocytes, Endothelial cells, Epithelial cells, Fibroblasts
- Biology Area
- Angiogenesis, Cell Biology, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Carson SD, et al. 1994. Blood 84:526.
2. McComb RD, et al. 1991. Am. J. Pathol. 139:491.
3. Whittle SM, et al. 1995. Thromb. Res. 79:451. - Gene ID
- 2152 View all products for this Gene ID
- UniProt
- View information about CD142 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD142 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD142 | NY2 | FC |
PE anti-human CD142 | NY2 | FC |
APC anti-human CD142 | NY2 | FC |
TotalSeq™-A0822 anti-human CD142 | NY2 | PG |
TotalSeq™-B0822 anti-human CD142 Antibody | NY2 | PG |
TotalSeq™-C0822 anti-human CD142 | NY2 | PG |
TotalSeq™-D0822 anti-human CD142 | NY2 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
Follow Us