TotalSeq™-D0867 anti-human CD94 Antibody

Product Details

Verified Reactivity

Human

Reported Reactivity

African Green, Baboon, Cynomolgus

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

NK cell line

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.

Concentration

0.5 mg/mL

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Application Notes

Additional reported applications (for the relevant formats) include: immunoprecipitation⁴, inhibition of NK cell-mediated lysis⁵, immunohistochemical staining of acetone-fixed frozen tissue sections, and spatial biology (IBEX)^6,7.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)

1. Mizuki M, et al. 2000. Sarcoidosis Vasc. Diffuse Lung Dis. 17:54.
2. Phillip J, et al. 1996. Immunity 5:163.
3. Lazetic S, et al. 1996. J. Immunol. 157:4741.
4. Lanier LL, et al. 1998. Immunity 8:693.
5. Wooden SL, et al. 2005. J. Immunol. 175:1383.
6. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
7. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed

RRID

AB_2941473 (BioLegend Cat. No. 305529)

Antigen Details

Structure

C-type lectin, type II transmembrane glycoprotein, covalently associates with NKG2, 43 kD

Distribution

NK cells , T subset

Function

Inhibits NK function

Cell Type

NK cells, T cells

Biology Area

Immunology, Innate Immunity

Molecular Family

CD Molecules

Antigen References

1. Lopez-Botet M, et al. 1997. Immunol. Rev. 155:165.
2. Moretta A, et al. 1997. Immunol. Rev. 155:105.

Gene ID

3824 View all products for this Gene ID

UniProt

View information about CD94 on UniProt.org

Documentation

• Technical Data Sheet (pdf)
• Certificate of Analysis
• Safety Data Sheet

Reviews

Related Protocols

• TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Pages & Pathways

Related FAQs

Other Formats

Certificate of Analysis