Loading...

TotalSeq™-D1183 anti-human CD261 (DR4, TRAIL-R1) Antibody

Pricing & Availability
Clone
DJR1 (See other available formats)
Regulatory Status
RUO
Workshop
HCDM listed
Other Names
TRAIL-R1, Apo-2, CD261, TNFRSF10A
Isotype
Mouse IgG1, κ
Barcode Sequence
GCCCTTCCTCATTTC
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
307213 10 µg £253
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

DR4 is 56 kD member 10A of the TNFR superfamily (TNFRSF10A), also known as TRAIL-R1, Apo-2, and CD261. It is expressed at low levels by activated T cells and some tumors. After TRAIL engagement, DR4 (TRAIL-R1), through activation of NF-κB, induces apoptosis in the TRAIL ligated cell.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Cynomolgus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Extracellular domain of DR4-human IgG1 Fc fusion protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: The DJR1 antibody is useful for immunofluorescent staining and flow cytometric analysis of DR4/TRAIL-R1 receptor expression. For most successful immunofluorescent staining results, it may be important to maximize signal over background by using a relatively bright fluorochrome-antibody conjugate (Cat. No. 307206) or by using a high sensitivity, three-layer staining technique (e.g., including a biotinylated antibody or biotinylated anti-mouse IgG second step (Cat. No. 405303), followed by SAv-PE (Cat. No. 405204)).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Uno K, et al. 2003. Blood 101:3658.
  2. Sato K, et al. 2005. J. Immunol. 174:4025.
  3. Lundqvist A, et al. 2006. Cancer Res. 66:7317. PubMed
  4. Chen KF, et al. 2011. J Pharmacol Exp Ther. 337:155. PubMed
  5. Sonnemann J, et al. 2012. Cancer Biol Ther. 13:417. PubMed
  6. Chandrasekaran S, et al. 2014. PLoS One. 9:111487. PubMed
RRID
AB_2941476 (BioLegend Cat. No. 307213)

Antigen Details

Structure
TNFR superfamily, 56 kD
Distribution

Activated T cells, tumor cells

Function
Induces apoptosis
Ligand/Receptor
TRAIL
Cell Type
T cells
Biology Area
Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Immunology
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Macfarlane M. 2003. Toxicol. Lett. 139:89.
2. Baetu T, et al. 2002. Cytokine Growth Factor Rev. 13:199.
3. Degli-Esposti M. 1999. J. Leukoc. Biol. 65:535.

Gene ID
8797 View all products for this Gene ID
UniProt
View information about CD261 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 04/11/2023

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account