TotalSeq™-D0123 anti-human CD326 (Ep-CAM) Antibody, CD326, 9C4

Pricing & Availability

Clone: 9C4 (See other available formats)
Regulatory Status: RUO
Other Names: Ep-CAM, tumor associated calcium signal transducer 1, epithelial cell surface antigen, epithelial glycoprotein 2, EGP2, adenocarcinoma associated antigen, TROP1
Isotype: Mouse IgG2b, κ
Barcode Sequence: TTCCGAGCAAGTATC
Ave. Rating: Submit a Review
Product Citations: publications

Compare all formats

Cat #

Size

Price

Quantity Check Availability

Save

324253

10 µg

£245

Check Availability

Need larger quantities of this item?
Request Bulk Quote

Description

CD326 is also known as Ep-CAM, tumor associated calcium signal transducer 1, epithelial cell surface antigen, epithelial glycoprotein 2, EGP2, adenocarcinoma associated antigen, and TROP1. CD326 is a type I transmembrane protein containing six disulfide bridges and one THYRO domain. This cell surface glycosylated 40 kD protein is highly expressed in bone marrow, colon, lung, and most normal epithelial cells and is expressed on carcinomas of gastrointestinal origin. Recently, it has been reported that CD326 expression occurs during the early steps of erythrogenesis. CD326 functions as a homotypic calcium-independent cell adhesion molecule and is believed to be involved in carcinogenesis by its ability to induce genes involved in cellular metabolism and proliferation. CD326 antigen is an immunotherapeutic target for the treatment of human carcinomas.

Product Details

Technical Data Sheet (pdf)

Product Details

Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: DU.4475 breast carcinoma
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the revelant formats) include: immunofluorescence, immunohistochemistry³, and spatial biology (IBEX)^4,5.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.
RRID: AB_2927878 (BioLegend Cat. No. 324253)

Antigen Details

Structure: Type I transmembrane protein, contains six disulfide bridges, one THYRO domain, approximate molecular weight 40 kD.
Distribution: Highly expressed in bone marrow, colon, lung, and most normal epithelial cells. Also highly expressed on carcinomas of gastrointestinal origin. Expressed during early erythrogenesis.
Function: Homotypic calcium-independent cell adhesion. CD326 is believed to be involved in carcinogenesis by its ability to induce genes involved in cellular metabolism and proliferation.
Modification: Glycosylated.
Cell Type: Embryonic Stem Cells, Epithelial cells
Biology Area: Cell Biology, Immunology, Stem Cells
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Strnad J, et al. 1989. Cancer Res. 49:314.
2. Munz M, et al. 2004. Oncogene 23:5748.
3. Rao CG, et al. 2005. Int. J. Oncol. 27:49.
Gene ID: 4072 View all products for this Gene ID
UniProt: View information about CD326 on UniProt.org

Documentation

Reviews

Review This Product

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Related Pages & Pathways

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD326 Reagents Request Custom Conjugation

Description	Clone	Applications
Purified anti-human CD326 (EpCAM)	9C4	FC,ICC,IHC
FITC anti-human CD326 (EpCAM)	9C4	FC
PE anti-human CD326 (EpCAM)	9C4	FC
APC anti-human CD326 (EpCAM)	9C4	FC
Alexa Fluor® 488 anti-human CD326 (EpCAM)	9C4	FC,SB
Alexa Fluor® 647 anti-human CD326 (EpCAM)	9C4	FC,ICC,SB
PerCP/Cyanine5.5 anti-human CD326 (EpCAM)	9C4	FC,SB
Biotin anti-human CD326 (EpCAM)	9C4	FC
Pacific Blue™ anti-human CD326 (EpCAM)	9C4	FC
Brilliant Violet 421™ anti-human CD326 (EpCAM)	9C4	FC
PE/Cyanine7 anti-human CD326 (EpCAM)	9C4	FC
Brilliant Violet 605™ anti-human CD326 (EpCAM)	9C4	FC
Brilliant Violet 650™ anti-human CD326 (EpCAM)	9C4	FC
Alexa Fluor® 594 anti-human CD326 (EpCAM)	9C4	IHC-P,ICC,SB
Purified anti-human CD326 (EpCAM) (Maxpar® Ready)	9C4	FC,CyTOF®
PE/Dazzle™ 594 anti-human CD326 (EpCAM)	9C4	FC
APC/Fire™ 750 anti-human CD326 (EpCAM)	9C4	FC
Brilliant Violet 510™ anti-human CD326 (EpCAM)	9C4	FC
Brilliant Violet 785™ anti-human CD326 (EpCAM)	9C4	FC
Brilliant Violet 711™ anti-human CD326 (Ep-CAM)	9C4	FC
TotalSeq™-A0123 anti-human CD326 (Ep-CAM)	9C4	PG
APC/Cyanine7 anti-human CD326 (Ep-CAM)	9C4	FC
Alexa Fluor® 700 anti-human CD326 (EpCAM)	9C4	FC
TotalSeq™-C0123 anti-human CD326 (Ep-CAM)	9C4	PG
TotalSeq™-B0123 anti-human CD326 (Ep-CAM)	9C4	PG
PE/Cyanine5 anti-human CD326 (Ep-CAM)	9C4	FC
TotalSeq™-D0123 anti-human CD326 (Ep-CAM)	9C4	PG
Spark UV™ 387 anti-human CD326 (Ep-CAM)	9C4	FC
Spark Red™ 718 anti-human CD326 (Ep-CAM) (Flexi-Fluor™)	9C4	FC
Spark Blue™ 574 anti-human CD326 (Ep-CAM) (Flexi-Fluor™)	9C4	FC
Spark Blue™ 550 anti-human CD326 (Ep-CAM) (Flexi-Fluor™)	9C4	FC

Certificate of Analysis

Go To Top Version: 1 Revision Date: 09/12/2022

For Research Use Only. Not for diagnostic or therapeutic use.

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.