- Clone
- 11C3C65 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CD223, LAG-3, LAG3, lymphocyte-activation gene-3
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CATTTGTCTGCCGGT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
369339 | 10 µg | 296€ |
CD223, also known as LAG-3, is a 70 kD type I transmembrane glycoprotein that is involved in T-cell signaling. Similar to CD4, CD223 binds MHC class II, but with a higher affinity. CD223 negatively regulates T-cell activation. It is expressed by activated T-cells and natural killer cells (NKs), as well as regulatory T-cells. It is transiently expressed on the surface of activated T-cells in acute conditions but high expression is maintained under tolerizing conditions. CD223 deficiency results in reduced tumor growth. CD223 and PD-1 can act in synergy and reverse exhausted phenotypes, improve tumor rejection, and control viral load.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human LAG-3 transfected cells.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The staining of clone 11C3C65 cannot be blocked by clone 7H2C65, which is another anti-human CD223 (LAG-3) antibody.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2892449 (BioLegend Cat. No. 369339)
Antigen Details
- Structure
- 70 kD transmembrane glycoprotein, Ig superfamily, highly homologous to CD4.
- Distribution
-
Activated T-cells and natural killer cells (NKs) and regulatory T cells.
- Function
- Negatively regulates T-cell activation.
- Ligand/Receptor
- Binds MHC class II molecules.
- Cell Type
- Dendritic cells, NK cells, T cells, Tregs
- Biology Area
- Immunology, Inhibitory Molecules
- Molecular Family
- CD Molecules, Immune Checkpoint Receptors
- Antigen References
-
1. Castelli C, et al. 2014. Oncoimmunology. 3(11):e967146.
2. Poirier N, et al. 2011. Clin. Exp. Immunol. 164:265.
3. Juno JA, et al. 2015. Retrovirology. 12:17.
4. Casati C, et al. 2006. Cancer Res. 66:4450. - Gene ID
- 3902 View all products for this Gene ID
- UniProt
- View information about CD223 on UniProt.org
Related FAQs
Other Formats
View All CD223 (LAG-3) Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD223 (LAG-3)
PHA stimulated (3-day) human peripheral blood lymphocytes we... -
Alexa Fluor® 647 anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
PE anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
FITC anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
PE/Cyanine7 anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
PerCP/Cyanine5.5 anti-human CD223 (LAG-3)
Peripheral blood mononuclear cells stimulated with anti-CD3/... -
Brilliant Violet 421™ anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
Brilliant Violet 650™ anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
Brilliant Violet 510™ anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
Brilliant Violet 785™ anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
Brilliant Violet 711™ anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
Brilliant Violet 605™ anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
Alexa Fluor® 488 anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
Biotin anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
PE/Dazzle™ 594 anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
APC/Fire™ 750 anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
TotalSeq™-A0152 anti-human CD223 (LAG-3)
-
TotalSeq™-C0152 anti-human CD223 (LAG-3)
-
TotalSeq™-B0152 anti-human CD223 (LAG-3)
-
TotalSeq™-D0152 anti-human CD223 (LAG-3)
-
Alexa Fluor® 700 anti-human CD223 (LAG-3)
Peripheral blood mononuclear cells were stimulated with anti... -
Pacific Blue™ anti-human CD223 (LAG-3)
Peripheral blood mononuclear cells stimulated with anti-CD3/... -
PE/Cyanine5 anti-human CD223 (LAG-3)
Anti-CD3/CD28 and recombinant IL-2 stimulated (three days) p... -
APC/Cyanine7 anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (3 days) peripheral blood mononucle... -
APC/Fire™ 810 anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
Brilliant Violet 750™ anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (three days) peripheral blood monon... -
Spark Red™ 718 anti-human CD223 (LAG-3) (Flexi-Fluor™)
-
Spark PLUS UV395™ anti-human CD223 (LAG-3)
CD3/CD28/IL-2 stimulated (3 days) human peripheral blood mon... Unstimulated peripheral blood mononuclear cells were stained... -
Spark Blue™ 574 anti-human CD223 (LAG-3) (Flexi-Fluor™)
-
Spark PLUS B550™ anti-human CD223 (LAG-3) Antibody
CD3/CD28/IL-2 stimulated (3 days) human peripheral blood mon... Unstimulated human peripheral blood mononuclear cells were s...
Follow Us