- Clone
- W6D3 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- HCDM listed
- Other Names
- Lewis X, 3-FAL, 3-FL, LNFP III, Lex, SSEA-1, X-hapten
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TCACCAGTACCTAGT
- Ave. Rating
- Submit a Review
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
323059 | 10 µg | 296€ |
CD15 is 3-fucosyl-N-acetyllactosamine (3-FAL) also known as Lewis X, 3-FAL, X-hapten, and SSEA-1. CD15 is expressed on granulocytes and monocytes. It has also been shown to be expressed on Langerhans cells. CD15 has been implicated in adhesion as well as chemotaxis, phagocytosis, and bactericidal activity.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- WERI-RB-1 retinoblastoma cell line
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2904344 (BioLegend Cat. No. 323059)
Antigen Details
- Structure
- Poly-N-acetyllactosamine
- Distribution
-
Neutrophils, eosinophils, monocytes
- Function
- Adhesion
- Cell Type
- Embryonic Stem Cells, Eosinophils, Neutrophils
- Biology Area
- Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
- Molecular Family
- CD Molecules
- Antigen References
-
1. Stocks SC, et al. 1990. Biochem. J. 268:275.
- Gene ID
- 2526 View all products for this Gene ID
- UniProt
- View information about CD15 on UniProt.org
Related FAQs
Other Formats
View All CD15 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Brilliant Violet 785™ anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes were stained with CD15 (... -
Purified anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes stained with purified W6... -
FITC anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes stained with W6D3 FITC -
PE anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes stained with W6D3 PE -
APC anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes stained with W6D3 APC -
Alexa Fluor® 488 anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes stained with W6D3 Alexa ... -
Alexa Fluor® 647 anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes stained with W6D3 Alexa ... -
PE/Cyanine5 anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes stained with W6D3 PE/Cya... -
PerCP anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes stained with W6D3 PerCP -
PerCP/Cyanine5.5 anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes were stained with CD15 (... -
Pacific Blue™ anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes stained with W6D3 Pacifi... -
Alexa Fluor® 700 anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes were stained with CD15 (... -
Brilliant Violet 510™ anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes were stained with CD15 (... -
PE/Cyanine7 anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes were stained with CD15 (... -
Brilliant Violet 605™ anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes were stained with CD15 (... -
Brilliant Violet 650™ anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes were stained with CD15 (... -
Purified anti-human CD15 (SSEA-1) (Maxpar® Ready)
Human PBMCs (blue) and RBC-lysed human whole blood cells (re... -
PE/Dazzle™ 594 anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes were stained with CD15 P... -
Brilliant Violet 421™ anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes were stained with CD15 (... -
APC/Fire™ 750 anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes were stained with CD15 (... -
FITC anti-human CD15 (SSEA-1)
Typical results from human peripheral blood granulocytes sta... -
Pacific Blue™ anti-human CD15 (SSEA-1)
Typical results from human peripheral blood granulocytes sta... -
TotalSeq™-A0392 anti-human CD15 (SSEA-1)
-
Brilliant Violet 711™ anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes were stained with CD15 (... -
APC/Cyanine7 anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes were stained with CD15 (... -
TotalSeq™-B0392 anti-human CD15 (SSEA-1)
-
TotalSeq™-C0392 anti-human CD15 (SSEA-1)
-
PE anti-human CD15 (SSEA-1)
Typical results from human peripheral blood granulocytes sta... -
APC/Fire™ 810 anti-human CD15 (SSEA-1) Antibody
Human peripheral blood granulocytes were stained with anti-h... -
TotalSeq™-D0392 anti-human CD15 (SSEA-1)
-
GMP FITC anti-human CD15 (SSEA-1)
Typical results from human peripheral blood granulocytes sta... -
Spark YG™ 593 anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes were stained with anti-h... -
GMP PE anti-human CD15 (SSEA-1)
Typical results from human peripheral blood granulocytes sta... -
GMP Pacific Blue™ anti-human CD15 (SSEA-1)
Typical results from human peripheral blood granulocytes sta... -
Spark Violet™ 500 anti-human CD15 (SSEA-1)
Human peripheral blood granulocytes were stained with anti-h... -
Spark UV™ 387 anti-human CD15 (SSEA-1)
Human peripheral blood leukocytes were stained with anti-hum... -
PE/Cyanine7 anti-human CD15 (SSEA-1)
Typical results from human peripheral blood granulocytes sta...
Follow Us