- Clone
- 8C11 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Cadherin-2, Neural cadherin
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CCTTCCCTTTCCTCT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
350823 | 10 µg | 296€ |
CD325 (N-cadherin) is a 130 kD, single pass transmembrane protein. Its extracellular region consists of five EC domains and has one cytoplasmic domain. N-cadherin is involved in organogenesis and maintenance of organ architecture by contributing to the sorting of heterogeneous cell types and in the cell adhesion needed to form tissues. N-cadherin is expressed by stem cells, myeloblasts, endothelial cells, and fibroblasts, and also is expressed in neural and muscle tissues and some types of carcinoma cells. CD325 associates with the cytoskeleton trough catenin proteins.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Recombinant human N-cadherin extracellular domain
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The mAb 8C11 recognizes the amino acids 92–593 of CD325, located between the extracellular cadherin structural domain (EC) 3 and 4. Additional reported applications (for the relevant formats) include: immunofluorescence1,3,6, motility inhibition of N-cadherin-expressing cells2, and Western blot2,4.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Navarro P, et al. 1998. J. Cell Biol. 140:1475. (IF)
- Kim JB. 2000. J. Cell Biol. 151:1193. (Block, WB)
- Puch S, et al. 2001. J. Cell. Sci. 114:1567. (IF)
- Wahl JK. 3rd, et al. 2003. J. Biol. Chem. 278:17269. (WB)
- Wein F, et al. 2010. Stem. Cell Res. 4:129. (FC)
- Jaggi M, et al. 2002. Cell. Commun. Adhes. 9:103. (IF)
- RRID
-
AB_2941529 (BioLegend Cat. No. 350823)
Antigen Details
- Structure
- Member of cadherin family, Single pass transmembrane protein, extracellular region consist of five EC domains, one cytoplasmic domain, 130 kD
- Distribution
-
Stem cells, myeloblasts, endothelial cells, fibroblasts, neural and muscle tissues, some types of carcinoma cells
- Function
- Embryonic development, maintain tissue architecture, cell sorting and cell adhesion in tissues, promote motility
- Interaction
- Catenins
- Cell Type
- Endothelial cells, Fibroblasts, Hematopoietic stem and progenitors, Mesenchymal Stem Cells, Neural Stem Cells
- Biology Area
- Cell Adhesion, Cell Biology, Cell Motility/Cytoskeleton/Structure, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells, Synaptic Biology
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Colomiere M, et al. 2009. Brit. J. Cancer 100:134.
2. Yan W, et al. 2010. J. Biol. Chem. 285:14042.
3. Mosnier JF, et al. 2009. Mod. Pathol. 22:182.
4. Gao L, et al. 2010. Stem Cells 28:564. - Gene ID
- 1000 View all products for this Gene ID
- UniProt
- View information about CD325 on UniProt.org
Other Formats
View All CD325 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
PE anti-human CD325 (N-Cadherin) | 8C11 | FC |
Purified anti-human CD325 (N-Cadherin) | 8C11 | FC,ICC,WB,Block |
APC anti-human CD325 (N-Cadherin) | 8C11 | FC |
Alexa Fluor® 488 anti-human CD325 (N-Cadherin) | 8C11 | FC |
PE/Cyanine7 anti-human CD325 (N-Cadherin) | 8C11 | FC |
PerCP/Cyanine5.5 anti-human CD325 (N-Cadherin) | 8C11 | FC |
Alexa Fluor® 594 anti-human CD325 (N-Cadherin) | 8C11 | ICC |
TotalSeq™-A0433 anti-human CD325 (N-Cadherin) | 8C11 | PG |
TotalSeq™-C0433 anti-human CD325 (N-Cadherin) | 8C11 | PG |
TotalSeq™-D0433 anti-human CD325 (N-Cadherin) | 8C11 | PG |
TotalSeq™-B0433 anti-human CD325 (N-Cadherin) | 8C11 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE anti-human CD325 (N-Cadherin)
Human acute myeloid leukemia cell line (KG1) were stained wi... -
Purified anti-human CD325 (N-Cadherin)
Human acute myeloid leukemia cell line (KG1) stained with CD... HUVEC cells were fixed with 1% paraformaldehyde (PFA) and th... -
APC anti-human CD325 (N-Cadherin)
Human acute myeloid leukemia cell line (KG1) was stained wit... -
Alexa Fluor® 488 anti-human CD325 (N-Cadherin)
Human acute myeloid leukemia cell line (KG1a) was stained wi... -
PE/Cyanine7 anti-human CD325 (N-Cadherin)
Human acute myeloid leukemia cell line (KG1a) was stained wi... -
PerCP/Cyanine5.5 anti-human CD325 (N-Cadherin)
Human acute myeloid leukemia cell line (KG1a) was stained wi... -
Alexa Fluor® 594 anti-human CD325 (N-Cadherin)
Human acute myeloid leukemia cell line (KG1) cells were fixe... -
TotalSeq™-A0433 anti-human CD325 (N-Cadherin)
-
TotalSeq™-C0433 anti-human CD325 (N-Cadherin)
-
TotalSeq™-D0433 anti-human CD325 (N-Cadherin)
-
TotalSeq™-B0433 anti-human CD325 (N-Cadherin)
Follow Us