- Clone
- P44-8 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- NKp44, NCR2, Activating NK receptor NKp44, natural cytotoxicity triggering receptor 2. lymphocyte antigen 95 homolog
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GGGCAATTAGCGAGT
- Ave. Rating
- Submit a Review
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
325129 | 10 µg | 296€ |
CD336 is also known as activating NK receptor NKp44 (NKp44), natural cytotoxicity triggering receptor 2, and lymphocyte antigen 95 homolog. It is a type I transmembrane protein, member of the natural cytotoxicity receptor family that contains one immunoglobulin-like domain. NKp44 has an apparent molecular weight of 44 kD and three isoforms are produced by alternative splicing. NKp44 is expressed on IL-2 activated NK cells and a subset of γ/δ T cells. NKp44 enhances NK cell mediated cytolysis of virus infected cells and tumor cells. NKp44 has been shown to associate with the intracellular adaptor DAP12.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- recombinant human NKp44
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The p44-8 antibody against human NKp44 has been shown to be useful for flow cytometry, stimulation of human NK cells via NKp44 in a redirected lysis assay, and blocking of NKp44 function in solution. Additional reported applications (for the relevant formats) include: stimulation of human NK cells via NKp44 in a redirected lysis assay, and blocking of NKp44 function in solution1,2. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 325104).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
- RRID
-
AB_2941493 (BioLegend Cat. No. 325129)
Antigen Details
- Structure
- Type I transmembrane protein, member of the natural cytotoxicity receptor family, contains one immunoglobulin-like domain. Approximately 44 kD. Three isoforms produced by alternative splicing.
- Distribution
-
IL-2 activated NK cells and cell lines, some γ/δ T cells activated in vitro
- Function
- NK cell triggering of cytolysis toward tumor targets and other target cells deficient in MHC class I molecules
- Interaction
- DAP12
- Cell Type
- NK cells, T cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Cantoni C, et al. 1999. J. Exp. Med. 189:787.
2. Allcock RJN, et al. 2003. Eur. J. Immunol. 33:567.
3. Cantoni C, et al. 2003. Structure. 11:725. - Gene ID
- 9436 View all products for this Gene ID
- UniProt
- View information about CD336 on UniProt.org
Related FAQs
Other Formats
View All CD336 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD336 (NKp44) | P44-8 | FC,Block |
Biotin anti-human CD336 (NKp44) | P44-8 | FC |
PE anti-human CD336 (NKp44) | P44-8 | FC |
APC anti-human CD336 (NKp44) | P44-8 | FC |
Alexa Fluor® 647 anti-human CD336 (NKp44) | P44-8 | FC |
PerCP/Cyanine5.5 anti-human CD336 (NKp44) | P44-8 | FC |
PE/Cyanine7 anti-human CD336 (NKp44) | P44-8 | FC |
TotalSeq™-C0802 anti-human CD336 (NKp44) | P44-8 | PG |
Ultra-LEAF™ Purified anti-human CD336 (NKp44) | P44-8 | FC,Block |
TotalSeq™-A0802 anti-human CD336 (NKp44) | P44-8 | PG |
APC/Cyanine7 anti-human CD336 (NKp44) Antibody | P44-8 | FC |
KIRAVIA Blue 520™ anti-human CD336 (NKp44) | P44-8 | FC |
PE/Fire™ 810 anti-human CD336 (NKp44) | P44-8 | FC |
TotalSeq™-D0802 anti-human CD336 (NKp44) | P44-8 | PG |
Spark Red™ 718 anti-human CD336 (NKp44) (Flexi-Fluor™) | P44-8 | FC |
TotalSeq™-B0802 anti-human CD336 (NKp44) Antibody | P44-8 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD336 (NKp44)
-
Biotin anti-human CD336 (NKp44)
Human PBMCs were stimulated with rhIL-2 for 9 days, then sta... -
PE anti-human CD336 (NKp44)
Human PBMCs were stimulated with rhIL-2 for 7 days, then sta... -
APC anti-human CD336 (NKp44)
Human PBMCs were stimulated with rhIL-2 for 7 days, then sta... -
Alexa Fluor® 647 anti-human CD336 (NKp44)
Human PBMCs were stimulated with rhIL-2 for 9 days, then sta... -
PerCP/Cyanine5.5 anti-human CD336 (NKp44)
Human peripheral blood lymphocytes were stimulated with reco... -
PE/Cyanine7 anti-human CD336 (NKp44)
Human peripheral blood lymphocytes were stimulated with reco... -
TotalSeq™-C0802 anti-human CD336 (NKp44)
-
Ultra-LEAF™ Purified anti-human CD336 (NKp44)
-
TotalSeq™-A0802 anti-human CD336 (NKp44)
-
APC/Cyanine7 anti-human CD336 (NKp44) Antibody
Human peripheral blood lymphocytes were stimulated with reco... -
KIRAVIA Blue 520™ anti-human CD336 (NKp44)
Human PBMCs were stimulated with IL2 for 7 days. Cells were ... -
PE/Fire™ 810 anti-human CD336 (NKp44)
Human peripheral blood lymphocytes were stimulated with reco... -
TotalSeq™-D0802 anti-human CD336 (NKp44)
-
Spark Red™ 718 anti-human CD336 (NKp44) (Flexi-Fluor™)
-
TotalSeq™-B0802 anti-human CD336 (NKp44) Antibody
Follow Us