- Clone
- 67D2 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Sialomucin CD164, MUC-24, multi-glycosylated core protein 24, MGC-24
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GAGGCACTTAACATA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
324815 | 10 µg | 296€ |
The 67D2 monoclonal antibody recognizes human CD164 also known as sialomucin CD164, MUC-24, and multi-glycosylated core protein 24. CD164 is a single pass transmembrane protein with short cytoplasmic tail that is highly N- and O-glycosylated. This protein contains sialic acid and a Ser-Gly motif that may serve as an attachment for a glycosaminoglycan side chain. Three splice variants of CD164 have been reported with apparent molecular weights ranging between 80-100 kD. CD164 is expressed in bone marrow, bone marrow stromal cells, and CD34+ hematopoietic cells myeloid and erythroid progenitors; and activated basophils. Expression has also been reported on a variety of carcinomas and leukemic cells and in the small intestine, colon, lung, and thyroid. CD164 plays a role in cell adhesion and proliferation and acts as a negative signaling molecule for hematopoietic progenitor cells. CD164 has also been reported to be involved in myogenic differentiation and cancer metastasis. The 67D2 antibody has been shown to be useful for the flow cytometric detection of human CD164, Western blotting under non-reducing conditions (detects an 80-100 kD protein as well as a high molecular weight aggregate of approximately 220 kD), and immunofluorescence.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- T-47D breast carcinoma line
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: Western blotting2,3 under non-reducing conditions (detects an 80-100 kD protein as well as a high molecular weight aggregate of approximately 220 kD), and immunofluorescence3.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Watt SM, et al. 1998. Blood 92:849.
- Watt SM, et al. 2000. Blood 95:3113.
- Doyonnas R, et al. 2000. J. Immunol. 165:840.
- Vogel W, et al. 2002. Haematologica 88:126.
- RRID
-
AB_2936565 (BioLegend Cat. No. 324815)
Antigen Details
- Structure
- Single pass transmembrane protein with short cytoplasmic tail. Highly N- and O-glycosylated, contains sialic acid and a Ser-Gly motif that may serve as an attachment for a glycosaminoglycan side chain. Three splice variants have been reported with apparen
- Distribution
-
Expressed in bone marrow, bone marrow stromal cells, and CD34+ hematopoietic cells myeloid and erythroid progenitors; activated basophils. Expressed on a variety of carcinomas and leukemic cells. Also expressed in the small intestine, colon, l
- Function
- Plays a role in cell adhesion and proliferation, negative signaling molecule for hematopoietic progenitor cells. Has also been reported to be involved in myogenic differentiation and cancer metastasis
- Cell Type
- Basophils, Hematopoietic stem and progenitors, Leukemia
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Zannettino ACW, et al. 1998. Blood 92:2613.
2. Havens AM, et al. 2006. BMC Cancer 6:195.
3. Lee YN, et al. 2001. Mol. Cell. Biol. 21:7696. - Gene ID
- 8763 View all products for this Gene ID
- UniProt
- View information about CD164 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD164 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD164 | 67D2 | FC,ICC,WB |
FITC anti-human CD164 | 67D2 | FC |
PE anti-human CD164 | 67D2 | FC |
TotalSeq™-A0821 anti-human CD164 | 67D2 | PG |
TotalSeq™-C0821 anti-human CD164 | 67D2 | PG |
TotalSeq™-B0821 anti-human CD164 | 67D2 | PG |
TotalSeq™-D0821 anti-human CD164 | 67D2 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD164
Human myeloid cell line KG1a stained with purified 67D2, fol... BT474 breast cancer cell line was stained with anti-human CD... -
FITC anti-human CD164
Human peripheral blood granulocytes stained with 67D2 FITC -
PE anti-human CD164
Human peripheral blood monocytes stained with 67D2 PE -
TotalSeq™-A0821 anti-human CD164
-
TotalSeq™-C0821 anti-human CD164
-
TotalSeq™-B0821 anti-human CD164
-
TotalSeq™-D0821 anti-human CD164
Follow Us