TotalSeq™-A0005 anti-human CD80 Antibody

Pricing & Availability
Clone
2D10 (See other available formats)
Regulatory Status
RUO
Workshop
VI CD80.1
Other Names
B7-1, B7, BB1
Isotype
Mouse IgG1, κ
Barcode Sequence
ACGAATCAATCTGTG
Compare all formats
Cat # Size Price Quantity Check Availability
305239 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD80, also known as B7-1, B7, and BB1, is a 60 kD single chain type I glycoprotein belonging to the immunoglobulin superfamily. CD80 is expressed on activated B and T cells, macrophages, and dendritic cells. CD80 binds to CD28 and CD152 (CTLA-4). Along with CD86, CD80 plays a critical role in regulation of T cell activation. The interaction of CD80 with CD28 provides a potent costimulatory signal for T cell activation through the CD3 complex, while its interaction with CTLA-4 provides an inhibitory signal for T cell activation.

Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: in vitro blocking of T cell activation, immunohistochemical staining of acetone-fixed frozen tissue sections2, immunoprecipitation, and Western blotting3. The Ultra-LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 305245 & 305246).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London.
  2. Battifora M. 1998. J. Clin. Endocr. Metab. 83:4130. (IHC)
  3. Van der Merwe PA, et al. 1997. J. Exp. Med. 185:3. (WB)
  4. Jayakumar A, et al. 2008. Infect. Immun. 76:2138. PubMed
  5. Schubert DA, et al. 2012. J. Exp Med. 209:335. PubMed
  6. Wen T, et al. 2014. J Immunol. 192:5481. PubMed
Product Citations
  1. Cook CP, et al. 2022. Cell Rep Med. 3:100715. PubMed
  2. Swanson E, et al. 2021. eLife. 10:00. PubMed
  3. Guilliams M, et al. 2022. Cell. 185:379. PubMed
  4. Hao Y, et al. 2021. Cell. 184:3573. PubMed
RRID
AB_2749958 (BioLegend Cat. No. 305239)

Antigen Details

Structure
Ig superfamily, type I transmembrane glycoprotein, 60 kD
Distribution

Activated B cells and T cells, macrophages, and dendritic cells

Function
T cell costimulation
Ligand/Receptor
CD28, CD152 (CTLA-4)
Cell Type
B cells, Dendritic cells, Macrophages, T cells, Tregs
Biology Area
Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Freeman G, et al. 1991. J. Exp. Med. 174:625.
2. Linsley P, et al. 1996. Immunity 4:535.
3. Linsley P, et al. 1991. J. Exp. Med. 174:561.

Gene ID
941 View all products for this Gene ID
UniProt
View information about CD80 on UniProt.org
Go To Top Version: 1    Revision Date: 07/13/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account