TotalSeq™-A0020 anti-human CD270 (HVEM, TR2) Antibody

Pricing & Availability
Clone
122 (See other available formats)
Regulatory Status
RUO
Workshop
HCDM listed
Other Names
TR2, Herpesvirus entry mediator A, Tumor necrosis factor receptor superfamily, member 14, TNFRSF14, Tumor necrosis factor receptor like 2, HVEM
Isotype
Mouse IgG1, κ
Barcode Sequence
TGATAGAAACAGACC
Cat # Size Price Quantity Check Availability
318813 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

The 122 antibody recognizes human HVEM also known as herpesvirus entry mediator A, tumor necrosis factor receptor superfamily, member 14, TNFRSF14, and tumor necrosis factor receptor like 2. HVEM, a member of the TNFR superfamily, is a type I transmembrane protein containing 2 TNF receptor domains with a predicted molecular weight of approximately 30 kD. HVEM is widely expressed in blood vessels, brain, heart, kidney, liver, lung, prostate, spleen, thymus and other organs. Resting T cells and naïve and memory B cells express high levels of HVEM as well. In humans, HVEM is not expressed in germinal center B cells. Immature dendritic cells express high levels of HVEM that is downregulated upon maturation. HVEM plays an important role in herpes simplex virus pathogenesis by enhancing entry into cells. Signaling through HVEM activates JNK1, NF-κB and AP-1 to control gene expression in response to infection or cellular stress and activate the immune response. HVEM binds to LIGHT and has also been shown to associate with several other proteins including TRAF1, TRAF2, TRAF3, TRAF5, B and T lymphocyte associated protein (BTLA), and estrogen receptor alpha.

Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Recombinant human HVEM protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The 122 antibody has been shown to be useful for flow cytometry, Western blot, and ELISA.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Cheung TC, et al. 2010. J. Immunol. 185:1949. PubMed
  2. Hobo W, et al. 2012. J Immunol. 189:39. PubMed.
Product Citations
  1. Guilliams M, et al. 2022. Cell. 185:379. PubMed
  2. Hao Y, et al. 2021. Cell. 184:3573. PubMed
RRID
AB_2734293 (BioLegend Cat. No. 318813)

Antigen Details

Structure
Member of the TNFR superfamily, type I transmembrane protein containing 2 TNF receptor domains. Predicted molecular weight approximately 30 kD.
Distribution

Widely expressed in blood vessels, brain, heart, kidney, liver, lung, prostate, spleen, thymus and other organs. Resting T cells and naïve and memory B cells express high levels of HVEM. Immature dendritic cells express high levels of HVEM that is downregulated upon maturation.

Function
Plays an important role in herpes simplex virus pathogenesis by enhancing entry into cells. Signaling through HVEM activates JNK1, NF-κB and AP-1 to control gene expression in response to infection or cellular stress and activate the immune response.
Interaction
TRAF1, TRAF2, TRAF3, TRAF5, B and T lymphocyte associated protein (BTLA), and estrogen receptor alpha have been shown to directly interact with HVEM in vivo.
Ligand/Receptor
LIGHT (TNFSF14), LTα
Cell Type
B cells, Dendritic cells, T cells
Biology Area
Cell Adhesion, Cell Biology, Immunology, Signal Transduction
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Carfi A, et al. 2001. Molec. Cell 8:169.
2. Gonzalez LC, et al. 2005.Proc. Nat. Acad. Sci. 102:1116.
3. Kwon BS, et al. 1997. J. Biol. Chem. 272:13471.
4. Marsters SA, et al. 1997. J. Biol. Chem. 272:14272.
5. Montgomery RI, et al. 1996. Cell 87:427.

Gene ID
8764 View all products for this Gene ID
UniProt
View information about CD270 on UniProt.org
Go To Top Version: 1    Revision Date: 05/30/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account