- Clone
- HI186 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- HCDM listed
- Other Names
- Cambridge pathology antigen 1 (CAMPATH-1), epididymal secretory protein 1
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- CTTTGTACGAGCAAA
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
316017 | 10 µg | $369.00 |
CD52, also known as Cambridge pathology antigen 1 (CAMPATH-1), is a 25-29 kD glycoprotein containing a large N-linked carbohydrate moiety. The actual molecule of CD52 is only 8-9 kD. It is expressed in the male reproductive tract and on virtually all lymphocytes (T and B cells), as well as macrophages/monocytes, eosinophils, and red cells. CD52 is thought to play a role in carrying and orienting carbohydrates. CD52 is a potent target for complement-mediated lysis and antibody-mediated cellular cytotoxicity and has been used as a depletion target for chronic lymphocytic leukemia (CLL)/lymphoma and immunosuppression. The HI186 antibody is useful for flow cytometry and immunohistochemistry.
Product Details
- Verified Reactivity
- Human
- Reported Reactivity
- Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human tonsil
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining of formalin-fixed paraffin-embedded tissue sections.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London.
- Product Citations
-
- RRID
-
AB_2734292 (BioLegend Cat. No. 316017)
Antigen Details
- Structure
- Unusually small glycopeptide containing N-linked carbohydrate moiety, GPI-linked membrane protein, approximate molecular weight 7 kD
- Distribution
-
Male reproductive tract (epididymis, seminal vesicle), T cells, B cells, macrophage/monocyte, eosinophil, erythrocytes, malignant lymphocytes
- Function
- Thought to play a role in carrying and orienting carbohydrates. Target for complement-mediated lysis and antibody-dependent cellular cytotoxicity, used as a depletion target for chronic lymphocytic leukemia/lymphoma therapy and immunosuppression.
- Cell Type
- B cells, Eosinophils, Erythrocytes, Macrophages, Monocytes, T cells
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
- Leukocyte Typing VI. Kishimoto T, et al. (Eds.) Garland Publishing Inc. (1997)
- Xia MQ, et al. 1991. Eur. J. Immunol. 21:1677.
- Kirchhoff C, et al. 1993. Mol. Reprod. Dev. 34:8.
- Xia MQ, et al. 1993. Biochem. J. 293:633.
- Gene ID
- 1043 View all products for this Gene ID
- UniProt
- View information about CD52 on UniProt.org
Other Formats
View All CD52 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
PE/Cyanine7 anti-human CD52 | HI186 | FC |
Purified anti-human CD52 | HI186 | FC,IHC-P |
FITC anti-human CD52 | HI186 | FC |
PE anti-human CD52 | HI186 | FC |
APC anti-human CD52 | HI186 | FC |
APC/Fire™ 750 anti-human CD52 | HI186 | FC |
PerCP/Cyanine5.5 anti-human CD52 | HI186 | FC |
PE/Dazzle™ 594 anti-human CD52 | HI186 | FC |
TotalSeq™-A0033 anti-human CD52 | HI186 | PG |
TotalSeq™-C0033 anti-human CD52 | HI186 | PG |
PE/Cyanine5 anti-human CD52 | HI186 | FC |
TotalSeq™-B0033 anti-human CD52 | HI186 | PG |
TotalSeq™-D0033 anti-human CD52 | HI186 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE/Cyanine7 anti-human CD52
-
Purified anti-human CD52
-
FITC anti-human CD52
-
PE anti-human CD52
-
APC anti-human CD52
-
APC/Fire™ 750 anti-human CD52
-
PerCP/Cyanine5.5 anti-human CD52
-
PE/Dazzle™ 594 anti-human CD52
-
TotalSeq™-A0033 anti-human CD52
-
TotalSeq™-C0033 anti-human CD52
-
PE/Cyanine5 anti-human CD52
-
TotalSeq™-B0033 anti-human CD52
-
TotalSeq™-D0033 anti-human CD52