TotalSeq™-A0045 anti-human CD4 Antibody

Pricing & Availability
Clone
SK3 (See other available formats)
Regulatory Status
RUO
Other Names
T4, Leu3a
Isotype
Mouse IgG1, κ
Barcode Sequence
GAGGTTAGTGATGGA
Cat # Size Price Quantity Check Availability
344649 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD4, also known as T4, is a 55 kD single-chain type I transmembrane glycoprotein expressed on most thymocytes, a subset of T cells, and monocytes/macrophages. CD4, a member of the Ig superfamily, recognizes antigens associated with MHC class II molecules and participates in cell-cell interactions, thymic differentiation, and signal transduction. CD4 acts as a primary receptor for HIV, binding to HIV gp120. CD4 has also been shown to interact with IL-16.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Evans RL, et al. 1981. Immunol. 78:544
  2. Arno A et al. 1999. J. Infect. Dis. 180:56
  3. Muech M, et al. 1997. Blood 89:1364
  4. Wang L, et al. 2012. Cytometry A. 81:567. PubMed
Product Citations
  1. Cook CP, et al. 2022. Cell Rep Med. 3:100715. PubMed
  2. Witkowski MT, et al. 2020. Cancer Cell. 37:867. PubMed
  3. Hao Y, et al. 2021. Cell. 184:3573. PubMed
RRID
AB_2749969 (BioLegend Cat. No. 344649)

Antigen Details

Structure
Ig superfamily, type I transmembrane glycoprotein, 55 kD
Distribution

T cell subset, majority of thymocytes, monocytes/macrophages

Function
MHC class II co-receptor, lymphocyte adhesion, thymic differentiation, HIV receptor
Ligand/Receptor
MHC class II molecules, HIV gp120, IL-16
Cell Type
Macrophages, Monocytes, T cells, Thymocytes, Tregs
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Center D et al. 1996. Immunol. Today 17:476.
2. Gaubin M et al. 1996. Eur. J. Clin. Chem. Clin. Biochem. 34:723.

Gene ID
920 View all products for this Gene ID
UniProt
View information about CD4 on UniProt.org

Other Formats

View All CD4 Reagents Request Custom Conjugation
Description Clone Applications
PerCP anti-human CD4 SK3 FC
Purified anti-human CD4 SK3 FC,IP
FITC anti-human CD4 SK3 FC
PE anti-human CD4 SK3 FC
PerCP/Cyanine5.5 anti-human CD4 SK3 FC
Biotin anti-human CD4 SK3 FC
PE/Cyanine7 anti-human CD4 SK3 FC
APC anti-human CD4 SK3 FC
APC/Cyanine7 anti-human CD4 SK3 FC
Alexa Fluor® 488 anti-human CD4 SK3 FC
Pacific Blue™ anti-human CD4 SK3 FC
Alexa Fluor® 700 anti-human CD4 SK3 FC
Purified anti-human CD4 (Maxpar® Ready) SK3 FC,CyTOF®
PE anti-human CD4 SK3 FC
Brilliant Violet 421™ anti-human CD4 SK3 FC
Brilliant Violet 510™ anti-human CD4 SK3 FC
Alexa Fluor® 647 anti-human CD4 SK3 FC
FITC anti-human CD4 SK3 FC
APC/Fire™ 750 anti-human CD4 SK3 FC
PE/Dazzle™ 594 anti-human CD4 SK3 FC
Pacific Blue™ anti-human CD4 SK3 FC
Brilliant Violet 785™ anti-human CD4 SK3 FC
Brilliant Violet 750™ anti-human CD4 SK3 FC
Brilliant Violet 605™ anti-human CD4 SK3 FC
Brilliant Violet 711™ anti-human CD4 SK3 FC
PE/Cyanine7 anti-human CD4 SK3 FC
TotalSeq™-A0045 anti-human CD4 SK3 PG
TotalSeq™-C0045 anti-human CD4 SK3 PG
PE/Cyanine5 anti-human CD4 SK3 FC
PerCP/Cyanine5.5 anti-human CD4 SK3 FC
Spark Blue™ 550 anti-human CD4 SK3 FC
Spark NIR™ 685 anti-human CD4 SK3 FC
APC anti-human CD4 SK3 FC
KIRAVIA Blue 520™ anti-human CD4 SK3 FC
APC/Fire™ 810 anti-human CD4 SK3 FC
PE/Fire™ 640 anti-human CD4 SK3 FC
PE/Fire™ 700 anti-human CD4 SK3 FC
PerCP anti-human CD4 SK3 FC
Spark Violet™ 538 anti-human CD4 Antibody SK3 FC
Spark YG™ 581 anti-human CD4 SK3 FC
Alexa Fluor® 660 anti-human CD4 SK3 FC
Spark YG™ 593 anti-human CD4 SK3 FC
PE/Fire™ 810 anti-human CD4 Antibody SK3 FC
APC/Fire™ 750 anti-human CD4 SK3 FC
Spark Blue™ 574 anti-human CD4 SK3 FC
GMP APC anti-human CD4 SK3 FC
TotalSeq™-B0045 anti-human CD4 Antibody SK3 PG
Spark Violet™ 423 anti-human CD4 Antibody SK3 FC
GMP Pacific Blue™ anti-human CD4 SK3 FC
Spark UV™ 387 anti-human CD4 SK3 FC
GMP PE anti-human CD4 SK3 FC
GMP FITC anti-human CD4 SK3 FC
Spark Red™ 718 anti-human CD4 SK3 FC
GMP PerCP anti-human CD4 SK3 FC
GMP PE/Cyanine7 anti-human CD4 SK3 FC
Spark Violet™ 500 anti-human CD4 SK3 FC
GMP PerCP/Cyanine5.5 anti-human CD4 SK3 FC
Brilliant Violet 650™ anti-human CD4 SK3 FC
PerCP/Fire™ 806 anti-human CD4 SK3 FC
Spark Blue™ 515 anti-human CD4 SK3 FC
GMP APC/Fire™ 750 anti-human CD4 SK3 FC
Spark Violet™ 423 anti-human CD4 SK3 FC
PerCP/Fire™ 780 anti-human CD4 SK3 FC
PE/Fire™ 744 anti-human CD4 SK3 FC
Spark PLUS UV395™ anti-human CD4 SK3 FC
Spark PLUS B550™ anti-human CD4 SK3 FC
Go To Top Version: 1    Revision Date: 07/12/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account