- Clone
- SK3 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- T4, Leu3a
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GAGGTTAGTGATGGA
| Cat # | Size | Price | Quantity Check Availability | ||
|---|---|---|---|---|---|
| 344649 | 10 µg | $369.00 | |||
CD4, also known as T4, is a 55 kD single-chain type I transmembrane glycoprotein expressed on most thymocytes, a subset of T cells, and monocytes/macrophages. CD4, a member of the Ig superfamily, recognizes antigens associated with MHC class II molecules and participates in cell-cell interactions, thymic differentiation, and signal transduction. CD4 acts as a primary receptor for HIV, binding to HIV gp120. CD4 has also been shown to interact with IL-16.
Product Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Evans RL, et al. 1981. Immunol. 78:544
- Arno A et al. 1999. J. Infect. Dis. 180:56
- Muech M, et al. 1997. Blood 89:1364
- Wang L, et al. 2012. Cytometry A. 81:567. PubMed
- Product Citations
-
- RRID
-
AB_2749969 (BioLegend Cat. No. 344649)
Antigen Details
- Structure
- Ig superfamily, type I transmembrane glycoprotein, 55 kD
- Distribution
-
T cell subset, majority of thymocytes, monocytes/macrophages
- Function
- MHC class II co-receptor, lymphocyte adhesion, thymic differentiation, HIV receptor
- Ligand/Receptor
- MHC class II molecules, HIV gp120, IL-16
- Cell Type
- Macrophages, Monocytes, T cells, Thymocytes, Tregs
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Center D et al. 1996. Immunol. Today 17:476.
2. Gaubin M et al. 1996. Eur. J. Clin. Chem. Clin. Biochem. 34:723. - Gene ID
- 920 View all products for this Gene ID
- UniProt
- View information about CD4 on UniProt.org
Other Formats
View All CD4 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PerCP anti-human CD4
Human peripheral blood lymphocytes were stained with CD4 (cl... -
Purified anti-human CD4
Human peripheral blood lymphocytes stained with SK3, followe... -
FITC anti-human CD4
Human peripheral blood lymphocytes stained with SK3 FITC -
PE anti-human CD4
Human peripheral blood lymphocytes stained with SK3 PE -
PerCP/Cyanine5.5 anti-human CD4
Human peripheral blood lymphocytes were stained with anti-hu... -
Biotin anti-human CD4
Human peripheral blood lymphocytes stained with biotinylated... -
PE/Cyanine7 anti-human CD4
Human peripheral blood lymphocytes stained with SK3 PE/Cyani... -
APC anti-human CD4
Human peripheral blood lymphocytes stained with SK3 APC -
APC/Cyanine7 anti-human CD4
Human peripheral blood lymphocytes were stained with anti-hu... -
Alexa Fluor® 488 anti-human CD4
Human peripheral blood lymphocytes stained with SK3 Alexa Fl... -
Pacific Blue™ anti-human CD4
Human peripheral blood lymphocytes stained with SK3 Pacific ... -
Alexa Fluor® 700 anti-human CD4
Human peripheral blood lymphocytes were stained with CD4 (cl... -
Purified anti-human CD4 (Maxpar® Ready)
Human PBMCs stained with 154Sm-anti-CD45 (HI30) and 174Yb-an... -
PE anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
Brilliant Violet 421™ anti-human CD4
Human peripheral blood lymphocytes were stained with CD4 (cl... -
Brilliant Violet 510™ anti-human CD4
Human peripheral blood lymphocytes were stained with CD4 (cl... -
Alexa Fluor® 647 anti-human CD4
Human peripheral blood lymphocytes were stained with CD4 (cl... -
FITC anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
APC/Fire™ 750 anti-human CD4
Human peripheral blood lymphocytes were stained with CD3 PE ... 
-
PE/Dazzle™ 594 anti-human CD4
Human peripheral blood lymphocytes were stained with CD4 (cl... -
Pacific Blue™ anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
Brilliant Violet 785™ anti-human CD4
Human peripheral blood lymphocytes were stained with CD4 (cl... -
Brilliant Violet 750™ anti-human CD4
Human peripheral blood lymphocytes were stained with CD4 (cl... -
Brilliant Violet 605™ anti-human CD4
Human peripheral blood lymphocytes were stained with CD4 (cl... -
Brilliant Violet 711™ anti-human CD4
Human peripheral blood lymphocytes were stained with CD4 (cl... -
PE/Cyanine7 anti-human CD4
Typical results from human peripheral blood lymphocytes sta... -
TotalSeq™-A0045 anti-human CD4
-
TotalSeq™-C0045 anti-human CD4
-
PE/Cyanine5 anti-human CD4
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Cyanine5.5 anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
Spark Blue™ 550 anti-human CD4
Human peripheral blood lymphocytes were stained with CD4 (SK... -
Spark NIR™ 685 anti-human CD4
Human peripheral blood lymphocytes were stained with CD3 (cl... -
APC anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
KIRAVIA Blue 520™ anti-human CD4
Human peripheral blood lymphocytes were stained with CD3 APC... -
APC/Fire™ 810 anti-human CD4
Human peripheral blood lymphocytes were stained with CD4 (cl... -
PE/Fire™ 640 anti-human CD4
Human peripheral blood lymphocytes were stained with CD4 (cl... -
PE/Fire™ 700 anti-human CD4
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
Spark Violet™ 538 anti-human CD4 Antibody
Human peripheral blood lymphocytes were stained with CD4 (cl... -
Spark YG™ 581 anti-human CD4
Human peripheral blood lymphocytes were stained with anti-hu... -
Alexa Fluor® 660 anti-human CD4
Human peripheral blood lymphocytes were stained with CD4 (cl... -
Spark YG™ 593 anti-human CD4
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Fire™ 810 anti-human CD4 Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
APC/Fire™ 750 anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
Spark Blue™ 574 anti-human CD4
Human peripheral lymphocytes were stained with anti-human CD... -
GMP APC anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
TotalSeq™-B0045 anti-human CD4 Antibody
-
Spark Violet™ 423 anti-human CD4 Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP Pacific Blue™ anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
Spark UV™ 387 anti-human CD4
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP PE anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
GMP FITC anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
Spark Red™ 718 anti-human CD4
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP PerCP anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
GMP PE/Cyanine7 anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
Spark Violet™ 500 anti-human CD4
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP PerCP/Cyanine5.5 anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
Brilliant Violet 650™ anti-human CD4
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Fire™ 806 anti-human CD4
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark Blue™ 515 anti-human CD4
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP APC/Fire™ 750 anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
Spark Violet™ 423 anti-human CD4
Typical results from human peripheral blood lymphocytes stai... -
PerCP/Fire™ 780 anti-human CD4
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Fire™ 744 anti-human CD4
Human peripheral blood mononuclear cells were stained with a... -
Spark PLUS UV395™ anti-human CD4
Human peripheral blood lymphocytes were stained anti-human C... -
Spark PLUS B550™ anti-human CD4
Human peripheral blood lymphocytes were stained with anti-hu...