TotalSeq™-A0051 anti-human CD14 Antibody

Pricing & Availability
Clone
63D3 (See other available formats)
Regulatory Status
RUO
Other Names
Monocyte differentiation antigen CD14, myeloid cell-specific leucine-rich glycoprotein, LPS receptor
Isotype
Mouse IgG1, κ
Barcode Sequence
CAATCAGACCTATGA
Cat # Size Price Quantity Check Availability
367131 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD14 is a 53-55 kD glycosylphosphatidylinositol (GPI)-linked membrane glycoprotein that is also known as the LPS receptor. CD14 is expressed at high levels on monocytes and macrophages, and at lower levels on granulocytes. Some dendritic cell populations such as interfollicular dendritic cells, reticular dendritic cells, and Langerhans cells have also been reported to express CD14. As a high-affinity receptor for LPS, CD14 is involved in the clearance of gram-negative pathogens and in the upregulation of adhesion molecules and cytokine expression in monocytes and neutrophils.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Purified human peripheral blood monocytes.
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Fridlender ZG, et al. 1999. Hum. Immunol. 11:1028.
  2. Devitt A, et al. 1998. Nature 6675:505.
Product Citations
  1. Leader AM, et al. 2021. Cancer Cell. 39:1594. PubMed
  2. Cook CP, et al. 2022. Cell Rep Med. 3:100715. PubMed
RRID
AB_2734412 (BioLegend Cat. No. 367131)

Antigen Details

Structure
GPI-linked membrane glycoprotein.
Distribution

Monocytes, macrophages, dendritic cells, and granulocytes.

Function
LPS receptor, clearance of Gram-negative pathogens.
Interaction
LPS.
Ligand/Receptor
LPS.
Cell Type
Dendritic cells, Granulocytes, Macrophages, Monocytes, Neutrophils
Biology Area
Cell Biology, Immunology, Neuroinflammation, Neuroscience
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References
  1. Stocks SC, et al. 1990. Biochem. J. 268:275.
  2. Wright SD, et al. 1990. Science 4975:1431.
Gene ID
929 View all products for this Gene ID
UniProt
View information about CD14 on UniProt.org
Go To Top Version: 1    Revision Date: 05/29/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account