TotalSeq™-A0074 anti-mouse CD54 Antibody

Pricing & Availability
Clone
YN1/1.7.4 (See other available formats)
Regulatory Status
RUO
Other Names
ICAM-1, Ly-47
Isotype
Rat IgG2b, κ
Barcode Sequence
ATAACCGACACAGTG
Cat # Size Price Quantity Check Availability
116127 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD54 is a 90 kD immunoglobulin superfamily member also known as ICAM-1 and Ly-47. It is expressed on activated endothelial cells, high endothelial venules (HEV), T and B cells, monocytes/ macrophages, granulocytes, and dendritic cells. CD54 is an important intracellular adhesion molecule that participates in T cell-T cell, T cell-B cell, and T cell-target cell interactions via binding of LFA-1 (CD11a/CD18) and Mac-1 (CD11b/CD18). CD54 has also been shown to be involved in lymphocyte trafficking, making it an important molecule in many immune reactions and inflammation. CD54 is also a receptor for rhinovirus. The YN1/1.7.4 antibody has been reported to block binding of mouse CD54 to LFA-1 and Mac-1, inhibit cell-cell adhesion, and function in antigen presentation to T cells and leukocyte migration to inflammatory tissues.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse NS-1 cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. This Ultra-LEAF™ solution contains no preservative; handle under aseptic conditions.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: in vitro and in vivo blocking of cell-cell adhesion and CD54 functions1,2,4, immunohistochemical staining3 of acetone-fixed frozen sections, immunoprecipitation4, and Western blotting (non-reducing). The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 116131-116136).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Kumaska T, et al. 1996. J. Clin. Invest. 97:2362. (Block)
  2. Horley KJ, et al. 1989. EMBO J. 8:2889. (Block)
  3. Burns AR, et al. 1994. J. Immunol. 153:3189. (IHC)
  4. Takei F, et al. 1985. J. Immunol. 134:1403. (Block, IP)
  5. Sumagin R, et al. 2010. J. Immunol. 184:5242. PubMed
  6. Bankoti J, et al. 2010. Toxicol. Sci. 115:422. (FC) PubMed
  7. Seidler DG, et al. 2011 J. Immunol. 187:6108. PubMed
  8. Chacko AM, et al. 2011. Curr Opin Colloid Interface Sci. 16:215. PUbMed
  9. El-Assaad F, et al. 2013. Infect Immun. 81:3984. PubMed
  10. Greineder CF, et al. 2013. PLoS One. 14:80110. PubMed
Product Citations
  1. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
RRID
AB_2734177 (BioLegend Cat. No. 116127)

Antigen Details

Structure
Ig superfamily, 90 kD
Distribution

Activated endothelial cells, high endothelial venules, T cells and B cells, monocytes/macrophages, granulocytes, dendritic cells

Function
Immune reaction, inflammation, adhesion
Ligand/Receptor
CD11a/CD18 (LFA-1) or CD11b/CD18 (Mac-1) and CD11c/CD18, CD43, hyaluronan, fibrinogen
Cell Type
B cells, Dendritic cells, Endothelial cells, Granulocytes, Macrophages, Mesenchymal Stem Cells, Monocytes, T cells
Biology Area
Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology, Innate Immunity, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Barclay AN, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Springer TA. 1990. Nature 346:425.
3. Rothlein R, et al. 1986. J. Immunol. 137:1270.

Gene ID
15894 View all products for this Gene ID
UniProt
View information about CD54 on UniProt.org
Go To Top Version: 1    Revision Date: 05/29/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account