TotalSeq™-A0075 anti-mouse CD90.2 (Thy1.2) Antibody

Pricing & Availability
Clone
30-H12 (See other available formats)
Regulatory Status
RUO
Other Names
Thy-1.2
Isotype
Rat IgG2b, κ
Barcode Sequence
CCGATCAGCCGTTTA
Cat # Size Price Quantity Check Availability
105345 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD90.2 is a 25-35 kD immunoglobulin superfamily member also known as Thy1.2. It is expressed on hematopoietic stem cells and neurons, all thymocytes, and peripheral T cells in Thy1.2 bearing mouse strains (Balb/c, CBA/J, C3H/He, C57BL/-, DBA, NZB/-). CD90.2 is a glycosylphosphatidylinositol (GPI)-anchored membrane glycoprotein involved in signal transduction. CD90.2 is involved in costimulation of lymphocyte proliferation and induction of hematopoietic stem cells differentiation. CD90.2 has been shown to interact with CD45. The 30-H12 antibody has been reported to induce Ca2+ flux in thymocytes and, in combination with antibody against the CD3/TCR complex, promote thymocyte apoptosis and inhibit CD3-mediated proliferative responses of mature T lymphocytes.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse thymus or spleen
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: in vivo and in vitro depletion1,2,7, costimulation of CD3/TCR-mediated signal transduction3,4, and immunohistochemical staining5 of acetone-fixed frozen sections. The 30-H12 antibody does not react with Thy-1.1 alloantigen of the AKR/J and PL strains. To reduce non-specific binding to cells bearing Fc-receptors, pre-incubation of cells with anti-mouse CD16/CD32, clone 93 (Cat. No. 101301 & 101302) is recommended prior to immunofluorescent staining. The Ultra-LEAF™ purified antibody (Endotoxin <0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 105351 & 105352).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Hathcock KS. 1991. Current Protocols in Immunology. 3.4.1. (Deplete)
  2. Seaman WE. 1983. J. Immunol. 130:1713. (Deplete)
  3. Nakashima I, et al. 1991. J. Immunol. 147:1153. (Costim)
  4. Nakashima I, et al. 1993. J. Immunol. 151:3511. (Costim)
  5. Ledbetter JA, et al. 1980. J. Exp. Med. 152:280. (IHC)
  6. Hardy B, et al. 2005. Int. Immunol. 17:615.
  7. Drobyski W, et al. 1996. Blood 87:5355. (Deplete)
  8. Dyer KD, et al. 2007. J. Immunol. 179:1693. (FC) PubMed
  9. Sungur CM, et al. 2013. PNAS. 110:7401. PubMed
Product Citations
  1. Kedmi R, et al. 2022. Nature. 610:737. PubMed
RRID
AB_2734166 (BioLegend Cat. No. 105345)

Antigen Details

Structure
Ig superfamily, 25-35 kD
Distribution

Hematopoietic stem cells and neurons, all thymocytes, peripheral T cells of the Thy-1.2 bearing mice

Function
Lymphocyte costimulation, proliferation and differentiation of hematopoietic stem cells
Ligand/Receptor
CD45
Cell Type
Hematopoietic stem and progenitors, Neurons, T cells, Thymocytes
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Craig W, et al. 1993. J. Exp. Med. 177:1331.
3. Reif AE and Schlesinger M. 1989. Cell Surface Antigen Thy-1.
4. Mayani H, et al. 1994. Blood 83:2410.

Gene ID
21838 View all products for this Gene ID
UniProt
View information about CD90.2 on UniProt.org

Other Formats

View All CD90.2 Reagents Request Custom Conjugation
Description Clone Applications
Biotin anti-mouse CD90.2 (Thy1.2) 30-H12 FC
FITC anti-mouse CD90.2 (Thy1.2) 30-H12 FC
PE anti-mouse CD90.2 (Thy1.2) 30-H12 FC
Purified anti-mouse CD90.2 (Thy1.2) 30-H12 FC,IHC-F,Costim,Depletion
APC anti-mouse CD90.2 (Thy1.2) 30-H12 FC
PE/Cyanine5 anti-mouse CD90.2 (Thy1.2) 30-H12 FC
Alexa Fluor® 488 anti-mouse CD90.2 (Thy1.2) 30-H12 FC,IHC-F
Alexa Fluor® 647 anti-mouse CD90.2 (Thy1.2) 30-H12 FC,IHC-F
Alexa Fluor® 700 anti-mouse CD90.2 (Thy1.2) 30-H12 FC
PerCP anti-mouse CD90.2 (Thy1.2) 30-H12 FC
Pacific Blue™ anti-mouse CD90.2 (Thy1.2) 30-H12 FC
PE/Cyanine7 anti-mouse CD90.2 (Thy1.2) 30-H12 FC
APC/Cyanine7 anti-mouse CD90.2 (Thy1.2) 30-H12 FC
Brilliant Violet 570™ anti-mouse CD90.2 (Thy1.2) 30-H12 FC
Brilliant Violet 785™ anti-mouse CD90.2 (Thy1.2) 30-H12 FC
Purified anti-mouse CD90.2 (Thy1.2) (Maxpar® Ready) 30-H12 FC,CyTOF®
Brilliant Violet 510™ anti-mouse CD90.2 (Thy1.2) 30-H12 FC
PerCP/Cyanine5.5 anti-mouse CD90.2 (Thy1.2) 30-H12 FC
Brilliant Violet 605™ anti-mouse CD90.2 (Thy1.2) 30-H12 FC
PE/Dazzle™ 594 anti-mouse CD90.2 (Thy1.2) 30-H12 FC
Brilliant Violet 421™ anti-mouse CD90.2 (Thy1.2) 30-H12 FC
TotalSeq™-A0075 anti-mouse CD90.2 (Thy1.2) 30-H12 PG
APC/Fire™ 750 anti-mouse CD90.2 (Thy1.2) 30-H12 FC
Brilliant Violet 711™ anti-mouse CD90.2 (Thy1.2) 30-H12 FC
Ultra-LEAF™ Purified anti-mouse CD90.2 (Thy1.2) 30-H12 FC,Depletion,Costim,IHC
TotalSeq™-C0075 anti-mouse CD90.2 (Thy1.2) 30-H12 PG
TotalSeq™-B0075 anti-mouse CD90.2 (Thy1.2) 30-H12 PG
PE/Fire™ 810 anti-mouse CD90.2 (Thy1.2) 30-H12 FC
Spark Blue™ 574 anti-mouse CD90.2 (Thy1.2) (Flexi-Fluor™) 30-H12 FC
Spark Red™ 718 anti-mouse CD90.2 (Thy1.2) (Flexi-Fluor™) 30-H12 FC
Go To Top Version: 1    Revision Date: 05/29/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account